> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.
That is one of the most incredible things I have ever read.
One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But, the RNA -> Protein equipment will just make protiens it without any problems.
Which, yeah, that's a miraculous discovery. And it was well worth the 2023 Nobel in Medicine.
Like, the whole system for gene editing in vivo that we've developed is just crazy little discovery after crazy little discovery. It's all sooooo freakin' cool.
I remember from a few few years back that the lipid coating may have caused problems for the liver, when treating people for diseases that needed to target a lot of tissue, such as muscle disorders. Is that still the case?
I suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect.
That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports.
That's bad if your goals are to detect genetically modified people and discriminate against them.
I see a near future where the kind of people who loathe things like vaccines and genuinely believe that vaccines can spread illness to the non-vaccinated feel the same way about other things like genetic modification and use legal mechanisms to discriminate and persecute people who are genetically modified.
> it will make people who are genetically modified in this fashion trivial to detect.
I'm not totally sure. If I understand it correctly, the mRNA contains pseudouridine, and it makes the protein that will edit the DNA. The edited DNA should look like a normal one.
I'm more concerned about the possible negative unintended consequences of making it available to everyone first. Genetic modification is well-explored Pandora's Box in science fiction and present humanity seems so ill-equipped in collective philosophy and reason to handle a paradigm shift of that magnitude.
Not OP, but presumably it's because it could cement a permanent divide between classes. We still have quite a bit of upward mobility in the US, but health is a tremendous predictor of future outcomes, so gating that to the rich is dangerous to the stability of society in that way.
If you're going to make the comparison with vaccines, and if history is any indication, the more realistic worry would be the other way around (since that's where the money is): that genetic modifications will be mandated, and that those who object will be discriminated against.
[And no, I am not anti-vax, nor anti-gene-editing.]
I don't know anything about gene editing, but my grandmother was a carrier of the BRCA mutation. It would have saved a lot of heartbreak in my family if that could have been detected and repaired. My aunt, mom, and brother (age 4) all died of cancer. I'm just glad that my mom didn't know she had the mutation and passed it on to her child.
It wouldn’t be crazy if I teleported 50 years in the future and heard someone tell me that not doing this is akin to child abuse. Obviously all suffering is relative, etc. etc., but it’s just interesting to imagine a world where the societal pressure to make a perfect child is high.
Careful with qualifiers there. I genuinely believe that vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented. For example, it's why only the inactivated (aka "dead" virus) polio vaccine has been used in the US since 2000.
I'm not arguing about whether the risks of the attenuated virus outweigh the benefits. I think the data are very clear there. (Heh -- and I'm sure the vast majority of people will agree with that statement, even if they disagree on what the clear answer is....)
It's just that one shouldn't mock a belief without including the necessary qualifiers, as otherwise you're setting up an argument that can be invalidated by being shown to be factually incorrect.
As for genetic modification of humans, IMO there are a lot of very good reasons to be wary, most of them social. Fatal hereditary conditions are obviously an easy call. What about autism (not saying there's a genetic link there to use, just a what if)? Or other neurodivergence? Like being a troublemaker in class? Or voting for the party that doesn't control the medical incentive structure? Heck, let's stick with the fatal hereditary conditions, and say the editing does not affect germ cells. Is it ok if the human race gradually becomes dependent on gene editing to produce viable offspring? Or let's say it does extend to germ cells. The population with resources becomes genetically superior (eg in the sense of natural lifespan and lower medical costs) to those without, creating a solid scientific rationale for eugenics. Think of it as redlining carved into our blood.
I don't think discrimination against the genetically modified is the only potential problem here.
As humans, we'll deal with these problems the way we've dealt with everything else transformational. Namely: very, very badly.
At one time organ transplants were considered an ethical grey area (perhaps they still are by some), but I think most people now would consider it better to save lives in such a manner when it only brings help to those who need it and it's possible to, compared to the alternative. Having the capability may mean that things like organ theft now exist, but the benefits around the world outweigh the nastiness that has always come as part of human nature.
I mean, I feel like autism is a terrible example here, it's not just some quirky personality trait, it's a reality people live with that runs the gamut from difficult to completely debilitating. Even the more mild forms of autism cause extreme difficulty in many aspects of life. If that was curable or preventable, that'd be great.
If it turns out some pathogen or chemical made me autistic, regardless of whether or not I could be cured as an adult, I'd have certainly preferred to live the reality where I had been as a child.
I think a better reason autism is a bad example is that part of its definition is that it is a consequence of fundamental brain structure and development (differentiating it from other psychological disorders which are acquired and more malleable). These aren't things you will "undo" with some gene edits. The whole brain has developed in a different way. Short of re-growing them a new brain you aren't going to change that (assuming you wanted to).
I think scientists have believed for a while that any type of “autism cure” would need to be extremely early intervention for maximum effectiveness for exactly this reason. I remember speaking with a team that was studying detection of autism in the womb for this exact reason.
Sure, the purpose was to illustrate a slippery slope, and curing autism is meant to be more obviously good than abolishing all forms of neurodivergence but less obviously good than fixing fatal hereditary diseases.
I'm not going to claim that I know the perfect place to draw the line.
> vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented
Nothing in medicine is certain. Nearly any medical treatment has a small chance it could kill you. There’s a small, but non-zero chance of a lethal infection even if they injected you with saline, odds that rise dramatically in less than sanitary conditions.
Ironically the use of the attenuated oral vaccine for polio was because of the risk of infection in places where the availability of sterile syringes was hard to guarantee. It’s all about the relative odds.
The reason that the body doesn't alarm as much to Pseudouridine, is that it's not a 'natural' RNA base. Meaning that, for the most part, nature really never uses it and so we haven't evolved to look out for it. Nature uses Uridine and so immune systems have evolved to look out for random bits of RNA in the body that use it and then clean that all up.
It's like if you're looking to clean up legos in you house with a romba that only cleans up legos. And all of a sudden it finds a duplo. It's going to take a hot second to figure out what to do with the duplo. And in that time, you can sneak by and build a duplo fort. (Look, I know this analogy is bad, but it's the best I can come up with on the fly, sorry. If anyone else wnats to come up with a better one, please do!).
The Pseudouridine is used up and degraded very quickly inside the cell, minutes at the very very longest, more like microseconds. It's just part of a messenger (the 'm' in 'mRNA') to tell the cell to do things.
You might see mRNA gene editing in factory farms, but it would just be easier to do germline editing instead and skip spraying animals, plants, and fungi. Why waste the equipment, right?
As I understand it, there is nothing in nature that can create it, so the mRNA can never be accidentally replicated. It’s a safety mechanism that prevents escape.
I’m not sure of by “they just suck” you meant to imply that they’re ineffective. If that’s the case, I strongly disagree. They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific. Nobody wants it used on them, so nobody uses it on anyone else.
I cannot imagine a more effective weapon than an invisible gas that melts you alive, and there are MANY chemical and bio examples of these types of weapons.
>> They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific
That’s the story but it doesn’t hold up. Chemical weapons were used as recently as the Syrian civil war. I also think if they were really effective in modern warfare, Russia would have long ago deployed them in Ukraine.
The ceiling for the destruction caused by biological weapons is far greater than chemical weapons. There is no chemical weapon that can hijack the victim to make more of it.
Not under the current way we do things, I don't imagine.
So the real trick here isn't the mRNA, it's the nanobubbles. Basically, you're putting these bits of mRNA into these little fat bubbles and then injecting those into the blood. Making those bubble shelf stable is really hard, hence the issues with temperature and the covid vaccine. To then make those little fat bubbles stable-ish in the blood is also a really hard thing to do. They have to get to the right places (in this baby's case, the liver) and then degrade there, drop off the mRNA, and not mess up other tissues all that much. Like, it's not terrible to make these micelles degrade in vivo, but to have them do that and not degrade in the tubes, ... wow... that is really difficult. There's a reason that Moderna is so highly valued, and it's these bubbles.
To try to then put these in a weapon that could do this though the airways would be, like, nearly impossible. Like, as in I think the second law of thermodynamics, let alone biology, and then simple industrial countermeasure like a N95 respirator, yeah, I think all of that makes it pretty much impossible to weaponize.
(Hedging my bets here: I don't know if they had to do all that with this baby, as you can kinda go from lab to baby really fast, since it's such a special case. But for mRNA based vaccines and cancer treatments, you have to deal with the shelf stable issue)
(Also, other bio people, yes, I am trying to explain to laymen here. Please chime in and tell me how I'm wrong here)
Something that a lot of people are unaware of is that US Military is allowed to do this. I forget the exact EO, but it was signed by Clinton and is in the 12333 chain of EOs. Mostly, this is used for the Anthrax vaccine. But, it does give clearance to do other forms of medical experimentation on warfighters.
No, really, I am serious here. This is true. I may have the details a bit off, so sorry there, but they can and do preform medical experiments on people without their consent. Now, to be fair, France does this too. They do sham surgeries over there. Non-consenting human medical experimentation is quite the rabbit-hole.
So, I can kinda see in the next 10 years, certainly the next 50, a routine shot given to warfighters to help them with things like blood loss, or vitamin C production, or fast twitch muscles, or whatever. The legal framework is already there and has been for a while, it's just an efficacy issue, honestly.
What do you mean? Is mRNA not used to produce the enzyme that these comments mentioned?
I don't think they were saying mRNA is gene editing itself. Just commenting on a modified mRNA helping the process compared to normal mRNA.
Might be misunderstanding though so correct me if I am
I dunno, I think they are being sloppy and conflating things. We can induce manufacture of proteins and can design proteins that carry out gene editing, so we can stack that knowledge together to induce cells to manufacture proteins that carry out gene edits, but it's the payload that is the gene editing, not the instruction to make the protein.
Given the merry movement to call the COVID vaccines gene editing, it rankles.
Hey, yeah, I'm not the most up to date on the current methods. Most of my knowhow is a bit out of date here. So thanks for piping up to correct things.
Do you know of any good resources that I can use to get up to speed on the exact methods they used for the baby?
My understanding, outdated as it is, is that we're using the mRNA to go in and create CRISPR-CAS9 slicers/dicers and additionally to that, the correct genes (not mRNA) to get stitched in. I would love to know more about how I am wrong here, as I am sure I'm not even close to really understanding it.
Cue the book "The Code Breaker" [0]. I read it a long time ago and such an incredible book and journey by Jennifer Doudna and Emmanuel Charpentier. Do check it out
I had heard about CRISPR a while back but most reporting on it kind of hand waved over the mechanisms of how it actually accomplishes its work. What these researchers have figured out to make this work absolutely blows my mind.
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene.
This isnt entirely unlike the method mRNA vaccines use. Through some clever biochemistry, mRNA vaccines get bits of code into cells where the cell's built in code compilers manufacture proteins that induce immunity.
We have developed software patches for our biology.
How does it know how to gps around? From what I know everything down there is a chemical reaction with some minimal physical motion, but how do you program it to know where to change and what and how.
It doesn’t know anything about where it “needs” to go. One of the weirder and more unintuitive things about molecular biology is just how fast everything moves inside a cell. The CRISPR molecule diffuses from one side of the nucleus to the other in a couple seconds and probably bumps into the entirety of the genome in a matter of minutes or hours. It’s very, very crowded inside cells, proteins and DNA and metabolites are constantly bumping into each other and are tumbling around at frankly incomprehensible rates. So, nothing needs to “know” where it needs to go, it simply gets pushed and jostled around until arrives there and then the attraction between the CRISPR’s RNA and the DNA takes over
Essentially you can design an rna molecular that contains a 20 nucleotide long sequence that can target your region of interest, with the caveat that there is a standard recognition sequence proximal to your sequence of interest (PAM sequence)
Gene therapies are pretty incredible. Some of them are still making a button-hole with a machete, but that's relative to the previous medical intervention of a button-hole with a tank's main gun.
One of the treatments for sickle-cell involves switching off the gene that makes the malfunctioning red blood cells, but of course that's not sufficient; you'd stop making red blood cells completely and you'd die. So it's combined with a modification that switches on a gene that all humans express pre-birth that causes your body to make "super-blood": red blood cells with significantly more binding points for oxygen. This is necessary because a fetus gets oxygen from its mother's blood, so the increased binding affinity is useful for pulling the oxygen towards the fetus at the placental interface. After birth, expression of that gene is disabled and regular RBC genes switch on.
So the therapy doesn't "fix" sickle RBCs; it disables the body's ability to make them and re-enables fetal RBCs! I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant, I imagine increased-affinity RBC could help for athletics... But I also imagine it requires more iron to generate them so has dietary impact).
High affinity RBCs would actually be a disadvantage for athletics. You actually don't need very high affinity to pick up oxygen from the lungs -- your lungs are comparatively extremely high in oxygen. What matters more is being able to drop the oxygen off in peripheral tissues. Higher affinity means that it's harder to actually deliver the oxygen, which is why we evolutionarily developed the switch away from fetal hemoglobin.
I have natural persistence of fetal hemoglobin which counteracts my inherited thalassemia trait.
No problems really..never knew I had it until I was told I had thalassemia trait as part of genetic testing. My hemoglobin panel shows fetal hemoglobin.
It's fundamentally different than a computer and arguably more complete.
The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem
If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.
Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)
Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.
Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.
Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).
True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.
Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined?
Someone should have said this to me:
> Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make.
>
> This is biology.
–Bert Hubert, “Our Amazing Immune System”
I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
I know someone well who works in this space, personalized gene therapy as cancer treatment.
> until it finds the exact DNA letter that needs to be changed.
This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details.
To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.
The approach they used which is base editing doesn’t actually insert or remove DNA, it actually uses an enzyme to convert one base to another, which is much safer as this doesn’t require a double strand break in DNA: https://blog.addgene.org/single-base-editing-with-crispr
That is interesting, I didn't catch the difference my first time through the article.
I do still question their claim of 100% precise results though. At least based on that high level description I can definitely see it being safer, but I question any scientific claim that is an absolute.
Specific to the editing vs insertion mechanism, I question how it doesn't run into similar constraints where the mechanics of targeting exact portions of the DNA can occasionally miss or impact the wrong segment of DNA entirely.
I haven't dug as deeply down the base pair conversion though, so I could absolutely be wrong!
If someone in the year 2050 was to pick out the most important news article from 2025, I won't be surprised if they choose this one.
For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body.
We still are struggling in most cases with how to deliver the DNA update instructions into the body. But given the pace of change in this space, I expect massive improvements with this update process over time.
Combined with AI to better understand the genome, this is going to be a crazy century.
The “How to make superbabies” article demonstrates a couple of fundamental misunderstandings about genetics that make me think the authors don’t know what they’re talking about at a basic level. Zero mention of linkage disequilibrium. Zero mention of epistasis. Unquestioned assumptions of linear genotype-phenotype relationships for IQ. Seriously, the projections in their graphs into “danger zone” made me laugh out loud. This is elementary stuff that theyre missing but the entire essay is so shot through with hubris that I don’t think they’re capable of recognizing that.
The EA community is generally incapable of self-awareness. The academic-but-totally-misinformed tone is comparable to reading LLM output. I've stopped trying to correct them, it's too much work on my part and not enough on theirs.
That's all very cool, but there are also articles like this one: https://www.theguardian.com/us-news/2025/feb/20/trump-nih-cu... - I'm not able to read the Times article because it's paywalled, but as other commenters have mentioned, this research was funded by the NIH, which the Trump administration is currently in the process of defunding. So, if further progress along this road will be made, it'll probably be much slower and less likely to be in the US.
As a father, the idea of being told my 1 week old baby is going to die would be my worst nightmare. The fact these doctors and scientists saved this childs life is a monument to modern medical science. This is absolutely insane. Hopefully the child doesnt need a liver transplant, but this is a great leap forward.
What an insanely callous and shallow take. I don’t even know where to start. You’re trying to claim the moral high ground by complaining that a privileged child didn’t suffer and die? Do you even understand the point of reducing poverty?
An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer.
How many people can even afford to get multiple opinions for a weird lump on their back? Or go to the dentist for a strange toothache? How many people can afford to get consistent exercise and eat healthy? How many lives would be saved or at least massively bettered? We already have the means to extend the life expectancy of the average person, and it's not being used. Obviously this is a wonderful medical advance, but it's depressing to wonder who it's for.
> An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer.
I'm as negative about the rich and powerful as anyone but this is such a cynical take - that might have been applied to many medical treatments in the past that have become relatively commonplace and easily accessible to people of all classes, at least in sane countries with sane healthcare systems.
Indeed, my view is heavily American-centric. And the trends of the past-- which you're right about-- may not apply to the future given increasing wealth inequality, the cost-of-living crisis, and the climate crisis (for which undoubtedly the poorest of us will be forced to shoulder most of the burden).
I'm explicitly not saying this work shouldn't be done, it should! But it does not exist in a vacuum, and it would be silly to pretend that it is not colored by vastly unequal access to modern healthcare. The reason I get excited about technology is because of the potential it holds for making us all happier and freer to do the things we like for longer. We are lost if we do not at least speak about the thunderclouds on the horizon for this philosophy of technology.
Certainly, you may choose to conduct yourself like this. I won't stop you! And other people who might've otherwise seen your point will be turned away from it. I prefer to have constructive conversations with people I view as equals, not stupid or infantile.
Observe that the replies to my post do engage with the argument I made.
Only 1% of the population has autism. Presenting autism as a considerable possibility for trollish behavior isn't much different than what the parent commenter did.
If you dont see the fundamental difference between a one week old baby dying and a 70 year old dying, you are beteft of humanity. One is a baby, one that is completely new to the world and totally innocent. The other is a person that has lives life and experienced life.
Please stop with the ad personam. Can you explain how this relates to my question (and you could answer it as well)? Also, is death of an older person worth less grievance?
A parent's obligation is to try and do everything they can to make their child's life good. I think most people would agree that living more than a week is a good thing.
So what? So a father shouldn't celebrate medical advances that mean their kid doesn't have to die after a week? And if it does, they should just be like "Ah, that's life!"
Oh, sorry. I definitely think a father can (should?) celebrate medical advancements like this, and definitely shouldn't undermine death like "Ah, that's life". My point is that people often worry about their children's death when they themselves are still alive. Death seems okay if it's when they don't get to see it
Edgy! No one has ever considered the mortality of their children ever, or contemplated the difference between death before and after the realization of potential. Wow!
Having a child predecease you is one of the worst things that can happen to a person in general. This is a common sentiment in humans. The strange thing is that you mentioned you're trying to follow "logic." This is not logic. These are emotions.
I understand this. My question arose from the fact that it seems like he only cares about the child dying before him, not the child's death overall. It was
> the idea of being told my 1 week old baby is going to die
I don't really know what you're going on about? We're all going to die, we all know that that's going to happen, but none of us want to suffer and most of us would like to live relatively long lives.
I am not a parent but I think if I did have a kid I would try everything I could to keep my child alive and minimize pain in my child's life.
We can pause and acknowledge that life (and what that means) will change, while also acknowledging that for many it will be the easiest decision in the world for it to change.
When my second son was born and was just so very tiny some genetic test came out questionable. We were very strongly encouraged to go to Childrens hospital ASAP to get more tests. He handled it well, being just a few weeks old. The tests came with "he's a carrier of something obscure but nothing to worry about", so it's all forgotten.
Three interesting thing come out of it from me. First, I was on Microsoft insurance which was quite gold plated at a time, a blessing only obvious in rear-view mirror, because Childrens was quite excited to continue any number of tests. Second, the technology of all this is absolutely amazing and I am so happy that it was available to me, and it has likely gotten better. Three, I want that tech to continue to expand and current destruction up there is going to hand this torch to someone else, which makes me sad.
> I was on Microsoft insurance which was quite gold plated at a time
One of the biggest perks of working for Microsoft for a long time was their health coverage. I can't tell you the number of times I'd be doing initial paperwork for a doctor's appointment and the receptionist would be like, "Oh you have THAT insurance, we're going to do all of the tests." I've heard they since cut back on it a little, but it truly was gold plated.
My niece in Australia has a rare genetic disorder and when my wife and I had our first baby in California a few years ago we were concerned about that. We also had fantastic insurance and the hospital team there did a test where they took a blood sample from my wife and seperated the childs DNA from the mothers in the blood sample and tested it for several genetic disorders. That test is not available in Australia even today.
> That test is not available in Australia even today.
Pretty much every lab test is available in Australia if you are willing to pay for it; if they don’t have a local lab capable of running the test, they’ll send the sample overseas
The real question is whether it is covered by insurance or not, and a lot of the time the answer is “no” - I recently forked out over US$500 for genetic tests on one of our kids (which the paediatrician recommended), although the results weren’t particularly helpful (“rare variant of uncertain clinical significance”)
Incredibly that test (cell-free fetal DNA - cfDNA) is now standard in California, to the point where most expecting parents in California now learn the baby’s gender super early. We learned our baby’s gender only 10 weeks into pregnancy because of the cfDNA test.
Yep, this effort is the culmination of 50 years of research. Could be the last harrah of the NIH with the amount of cuts we've had and the scientists who are taking jobs in other countries.
Not to mention the long arcs of the careers of scientists and support staff involved in this breakthrough, who were also supported by federally funded research grants.
Interesting view as many people were so anti-MRNA vaccine because "it was created too fast" oblivious to the years/decades of study in that field that allowed for that "too fast" to happen.
I guess it's still too early in this story's news cycle for the people with anti-views to be making noise yet. No GMOs, but human gene modification is okay. No cloning either. The boogeyman is gonna get us no matter what we do
As the father of a 5 year old boy with a genetic degenerative muscular disease whose lifespan will depend directly on how fast these technologies progress, I have difficulty responding in a civilized manner to the pointless, cruel, and stupid actions of the Administration in this regard. Rage is the word.
It is breathtaking to consider how the members of the Administration and their children, parents, and grandparents have benefited from NIH-funded research in innumerable ways that they are shamefully unaware of, every time they visit the doctor or the ER.
I have the same rage. But it extends equally to those who voted them in and donated to their campaigns, including my own family members.
They have created a huge rift in this country and I am still trying to figure out if I will forgive my family members and what they'd have to do to set us on a path towards reconciliation.
When there's a contract in place to conduct pediatric cancer research, and the government decides one day to break that contract, and it takes courts to rectify the situation, and then the government defies the courts, and the voters are cheering on the illegal actions of the politicians, well, rage is a mild word for what I feel.
The Secretary of Health and Human Services is a conspiracist that doesn't believe in vaccines and swims in sewers with his toddler to prove a point about "natural immunity" [1]. The new Surgeon General prayed to the stars and the trees and took mushrooms to "get ready for partnership" [2]. This is the party of so-called "rationalists".
Fascism has a long history of rejecting rationalism and science, and of embrassing esotericism [3]. Something our representation of nazis in media did a terrible job at conveying. We always see nazis as cold, calculating and rational when they are anything but.
> But KJ’s treatment — which built on decades of federally funded research — offers a new path for companies to develop personalized treatments without going through years of expensive development and testing.
Really incredible story and I'd love to know the process for receiving this, for example FDA approval etc. It's nice to see such in-your-face results from Federal funding programs. Without being political, it's sometimes hard for regular people to appreciate just how much good actually comes out of Federal Funding. There was another thread where someone even said something along the lines of : "Well during war things get done faster" . This simply isn't true. It might be done louder but Federal Funding never stopped pushing things forward.
Here's the thing - likely few would have noticed. We are structurally blind to the places in which public investment would have made our lives better, especially when they are things like scientific research that the vast majority never think about until it produces results.
I mean, the article is explicitly written to put it on your mind:
"The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services."
"But KJ’s treatment — which built on decades of federally funded research"
"The result “is a triumph for the American peoples’ investment in biomedical research,” Dr. Urnov said."
"The researchers emphasized the role government funding played in the development."
"The work, they said, began decades ago with federal funding for basic research on bacterial immune systems. That led eventually, with more federal support, to the discovery of CRISPR. Federal investment in sequencing the human genome made it possible to identify KJ’s mutation. U.S. funding supported Dr. Liu’s lab and its editing discovery. A federal program to study gene editing supported Dr. Musunuru’s research. Going along in parallel was federally funded work that led to an understanding of KJ’s disease."
"“I don’t think this could have happened in any country other than the U.S.,” Dr. Urnov said."
This is an article about federal funding of medical research with a cute baby as the human interest bit.
It would be nice, but you know how politics can usually turn into a bit of a toxic environment online. That said, I personally don't see the DOGE thing as anything other than a way to reduce the power of regulatory enforcement. I'm sure someone who would want that would never be conflicted with interests there...
I'm not an expert, but I have learned that FDA approval is not actually necessary for treatments and drugs. Your doctor has a lot of leeway when it comes to treatment but she of course experiences more risk of accusations of malpractice when prescribing off label drugs or unapproved treatments. insurance will also rarely cover treatment that is not FDA approved. the requirement for FDA approval generally has more to do with your legal ability to market the drug, treatment, or product.
That's actually super interesting and kinda great to hear, I guess my follow up question is obvious but would insurance companies cover that kind of procedure in the US? I get the impression it wouldn't be.. but if out of pocket.. I know I'd absolutely do anything for my kid.
My experience is quite the opposite - I'm actually thinking about subscribing to the NYT (again) or The Atlantic (despite their higher cost) purely for the quality of their writing.
You complain about oversimplification, then in the same breath complain about "random political stuff" being included. How is that not hypocritical, at best? This medical breakthrough would literally have not been possible without "politics". Get your head out of the sand. No one should be able to escape learning how their politics affects them or the society they are a part of. And if you want to enjoy the benefits of that society, then you don't get to complain about being reminded of how those benefits were achieved.
Pandering to people's fragile political sensibilities is how the U.S. got to this point where millions of citizens voted against their own self-interest because they thought candidates running on anti-intellectual, anti-science platforms was worth the zero sum "win".
Enjoy your weekends, eight hour workdays, clean air, and clean water—whether you like that those were all political or not!
NYT isn’t super specific here, but they made it sound like the disease treated is liver related. My understanding is that the liver is a good place to start with CRISPR-type gene treatments, in that the liver normally deals with anomalous shit in your bloodstream, say, like CRISPR type edits. So anywhere outside the liver is going to be significantly harder to get really broad uptake of gene edits.
It’s crazy encouraging that this worked out for this kid, and I’m somewhat shocked this treatment was approved in the US - I don’t think of us as very aggressive in areas like this. But to me, really hopeful and interesting.
You are right, current CRISPR systems tends to accumulate in the liver. Most CRISPR companies have shifted their focus to the liver over time because it's easiest to deliver there. Most viruses people use to target other organs are not large enough to carry CRISPR and lipid nanoparticles with CRISPR seem to like ending up in the liver and are hard to deliver at dose to hit other organ systems. It has been one of the big struggles of CRISPR companies. That being said, this is a huge deal and very encouraging.
As to the FDA stance, it tends to be more willing to go ahead with compassionate uses like this when it's clearly life or death.[1]
People born with this lack the enzyme CPS1, which screws up the urea cycle and causes a build up of ammonia. Ammonia build up is bad for your nervous system.
I hate to break it to you, but it will be substantially more difficult to target other organ systems. The liver is uniquely easy to target with our current vectors.
Right off the bat, the liver receives roughly a quarter of all cardiac output, either directly or second hand from the digestive organs. Additionally, the liver has a fenestrated endothelium which, while not completely unique in the body, uniquely allows molecules like lipid nanoparticles (LNPs) to access liver cells. Finally, the liver is the site of most lipoprotein processing, and LNPs can be designed to take advantage of the existing pathways to get the gene editing mRNA into the hepatocytes. All this is to say that if you have a genetic condition that primarily effects the liver, there's a lot more hope for treatment in the near term than for others.
Good lecture on the difficulties of finding appropriate platforms for delivering gene therapies to cells for anyone interested [1]
No they were not. A vaccine triggers an immune response, not a functional change.
mRNA vaccines are highly localized: you get a sore arm because most of it only gets taken up by muscle cells around the injection site, which spend some time producing the antigen and triggering a primary immune response (the inflammation aka the sore arm).
As for being localized it's true however after vaccine dose S proteins have been detected also in remote locations in the body because you can't make something 100% localized.
If you had an infusion that doesn't trigger immune system you could just increase the dose significantly, put it in the blood and most likely it would have reached all cells that blood reaches.
Last I heard those gene editing things lead to so called of-target edits, so they were basically corrupting random dna. Now in this case the baby would have died without this treatment so clearly benefits outweight the risks. But even then they probably want to have the dose be as low as possible.
Countless preventable dead children up ahead because that demented lunatic is dismantling basic vaccination in the US. Easily preventable deaths. And never mind the kneecapping of NIH grants (which are largely responsible for this story), or the federal blacklisting of (among others) Univ. of Pennsylvania (where the physician in the OP is based at), over nonsense culture war posturing.
Such endless stupidity. Such a senseless, senseless waste of lives.
Hmm, I thought clinical gene editing (gene therapy) was frowned upon because it's inherently risky and fraught with ethical hazards. What technically and ethically has changed since 2005 beyond CRISPR?
Germline gene editing is still considered risky and unethical. That is, editing cells that form eggs and sperm, thus changing the genome of some of the descendants of the edited person. This is somatic editing. These edits will not be inherited.
Somatic editing is becoming more common (see Casgevy) but there are technical hurdles that prevent its application to many cases.
What does this mean for longevity research? Could the same treatment potentially be adapted to make edits that could lengthen lifespan of healthy people?
Also it seems like you think the mRNA vaccines were harmful. Can you briefly describe what mRNA is and how the mRNA vaccines would have harmed this child?
The wealthy are already engaged in eugenics via IVF embryo selection. There are several American startups whose clientele are mainly rich SV types that want to optimize the genetics of their children.
Heck, if parents could provide a trust fund for their kids in a way that their kids couldn't piss it away, they'd be all over it. (I'm sure this exists to varying degrees.)
Look at what wealthy parents already do to get their kids into colleges or out of jail. I think it's ridiculously naive to think that we parents wouldn't jump at the chance to write generational wealth into our kids' genes.
(This is not an argument that developing this capability is a bad thing and should be stopped.)
Fertility care often already included testing for common genetic disorders, and parents with a history of severe disease would often make the hard choice to try again. Due to recent Theocratic political shifts, it means more families will face the worst possible life for their children.
Gattaca was a film years ahead of its time, and raises the question of what happens when people try to "fix" human beings beyond disease prevention. A subtle, but important ethical difference. =3
Disease is fuzzy word, it basically means below some made up bar for healthiness. Take dyslexia as a simple example. That disease can by definition not exist in an illiterate population. We have raised the bar and now they are diseased in need for a cure.
The more we things we cure the higher we will reach and the higher we reach the higher we will raise the bar. I don't think that's a bad thing, but its worth bearing in mind.
One can not simply raise valid concerns about gene editing technologies in the hands of the entities that don't hesitate sending people en masse to kill and die and otherwise manifest their fascist cravings in the open, here on HN and walk away undownvoted
I think it was here a few years ago that I read a comment saying that sick children will be the Trojan horse for normalizing gene editing of humans, because who could say no to sick children, right? Well, guess it's here now, so how long utill the eugenics wars start?
If you can affect germline cells, then I don't see how it's not a slippery slope. (I'm not arguing against doing it, just that it is a slope and the slope is slippery.) No designer babies necessary.
I'll steelman "fixing defects" by sticking to serious hereditary diseases (and yes, only those that correspond to one or a few known genes). As more and more conditions become treatable, the population with access to resources will have lower healthcare costs by being less susceptible to problems. (Which is a good thing, note!) Insurance companies will have more and more proxies for differentiating that don't involve direct genetic information. Societally, "those people" [the poor and therefore untreated] cost more to support medically and are an increasing burden on the system. Eugenics gains a scientific basis. Do you want your daughter marrying someone genetically substandard, if you don't have the resources to correct any issues that might show up? Probably not, you're more likely to want to build a wall between you and them. Then throw over anyone who falls behind the bleeding edge of corrections.
It'll be the latest form of redlining, but this time "red" refers literally to blood.
I'm a fan of saying there's always a slippery slope, it's just a matter of the parameters.
But, I think that it's misguided to apply the human problem of othering to a given technology. Regardless of technology X, humans are gonna human. So, if X helps some people, we should consider it on that basis. Because without X, we will still have an endless stream of other reasons to draw red lines, as you allude to. Except in addition we'll also still have the problem that X could've helped solve.
If gene editing to cure diseases leads to a future where people want to shunt off the poor that are now the outsized burden of the healthcare system, the answer from where I sit is to find ways to make the gene therapies available to them, not to cart them off to concentration camps while they await extermination. This will require all the trappings of human coordination we've always had.
Preventing X from ever coming to fruition doesn't at all prevent all possible futures where concentration death camps are a possibility. To me they are orthogonal concerns.
Even if you can convince one culture/society not to do it, how do you stop others? Force? Now you have a different manifestation of the same problem to solve. Society needs to learn how to "yes, and..." more when it comes to this stuff. Otherwise, it's just war all the way down.
>For this reason I do not think that curying diseases will lead to designer babies.
Well, you're wrong. Where is the line drawn for what constitutes a disease? Retardation? Autism? Eventually every child below, say, 130 IQ will be considered disabled and unable to find work.
Apply this to every other trait: cardiovascular health, strength, height, vision, etc. All forms of weakness can be considered a disease. The end product of eugenics is that mankind will be made into a docile and fragile monoculture.
>If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes.
And? it's obvious that the technology will eventually be capable of this, just not all at once. It starts with single-gene mutations, then it will be 10's of genes, and then hundreds and thousands.
That is the slippery slope: there is absolutely nothing about your reasoning that prevents one step from leading to another.
He wasn't saying that curing diseases wouldn't lead to designer babies because he objects to the idea (though he might). He's saying that the factors that lead to a "130 IQ" score are, to the extent that they're causatively genetic at all, highly polygenic. Molecular genetics results aren't putting us on a track to predict polygenic behavioral traits (I guess except smoking?), let alone control them.
It's helpful to evaluate claims on this thread in the context of the story. It's possible (though still a very open question) that complex behavioral traits will generally become predictable or maybe even controllable in the future. But those would require breakthroughs (including basic science discoveries breaking in the direction baby-designers want them to) more significant than the announcement on this story.
No, you're assuming that polygenic trait control "scales" like a sort or even a search algorithm, when there's some molecular genetic evidence that it may instead scale like a cipher key size.
For a nice thoughtful imagination of said future, Nancy Kress's Beggars in Spain https://en.wikipedia.org/wiki/Beggars_in_Spain suggests one possible outcome. It has both gene editing to make better humans and unproductive masses. A short yet powerful read.
it's unclear the outcome of this will be eugenics wars.
Answering the real question- it's unlikely these techniques will see widespread "recreational" usage any time soon, as they come with a wide range of risks. Further, the scientific community has learned a lot from previous eugenics programs; anything that happens in the future will happen with both social and political regulation.
It's ultimately hard to predict- many science fiction writers have speculated about this for some time, and social opinion can change quickly when people see new developments.
That's part of why the trojan horse works so well, what is an unacceptable risk for someone healthy can easily be acceptable for someone with an otherwise untreatable condition. Then by the experience and knowledge gained, it becomes less risky for everyone.
I think one reason why people won't have children is the gene-editing and the IVF that is coming. Nothing is left to chance, or to god any more. Having children is now a clinical affair. It's spiritually void.
I think part of the problem is that “really good” and “really bad” are not universally accepted norms for any given ethical question. What you’re seeing is your own value system assumptions being checked.
It’s perfectly reasonable to say that while a technology has the propensity to be used for evil, it also has positive applications and that the real benefit now outweighs the potential downside in a hypothetical future.
Otherwise you will go down a rabbit hole at the bottom of which lies a future where we all just kinda dig in the dirt with our hands until we die because every technological innovation can be used in a variety of ways.
Like, it’s silly to me that I can’t bring a 1.5” blade keychain utility knife on a flight, and then they hand me a metal butter knife in first class. I could do way more damage with that. But they allow the butter knife because the utility has shown to far outweigh the potential downside that hasn’t manifested.
> I will slaughter a baby if I know for a fact that baby will grow up to be the next Hitler
This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
>This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
It's true. But things like this should be easy to say right? Like we may not be able to act logically. But we should be able to think logically, communicate logically and show that we are aware of what is logical.
My post got flagged meaning a lot of people can't separate the two things. So for example I may not be able to kill the baby in reality, but I can at least see how irrational I am.
The person who flagged me likely not only can't kill the baby. He has to construct an artificial reality to justify why he can't kill the baby and why his decision must be rational.
I think things like that should be easy to say, if by that you mean censorship. Sure. But talk is cheap. And there are gradations of reality.
It would maybe be easier for a 15-25 y.o. to kill a baby they don't know and whose parents/family they don't know, and maybe even easier if they don't speak their language or look like them. Of course, the baby wouldn't be the only one you'd have to kill, most likely.
I submit that it would be very very different if you found out that your 4 year old child was going to go on to be the next Hitler. For a "normal" person, I think they would go to the ends of the earth to try to shape them into the kind of person that wouldn't do it. I think very few people would coldly calculate "welp, guess I gotta execute this adorable little child I've grown so attached to" as it looks up at them saying "I love you so much forever, mommy/daddy" with their little doe eyes.
(ETA: it also brings up side questions about nature vs nurture and free will)
And then consider the lifelong repercussions of the emotional fallout. You can use all the logic in the world to justify the action, but your human brain will still torment you over it. And likely, most of the other human brains that learn about it would torment you as well.
---
So, while I think you can say things like that, ie the ability and allowance, I think you should question whether you should. I think saying those kinds of things really doesn't add much to the discussion because I believe it's really just an uninformed platitude that only someone with a lack of life experience would believe.
For me this all highlights the fact that meaty ethical questions don't have a simple reductive answer. Which ties back in to the original problem that OP outright states that this is simply and clearly the wrong path to go down.
(PS the downvoting/flagging could be due to breaking the guidelines around discussing downvotes and flags, and not actually due to the topical content of the posts, and/or assuming bad faith on the part of other users as such: https://news.ycombinator.com/newsguidelines.html)
I would if I can foresee the future. But with eugenics you can't foresee the future. Self artificially selecting for genetic traits doesn't guarantee a good future. There's no gene for recreating Hitler either.
A baby Hitler gaurantees a future with a grown up Hitler. Killing the baby eliminates that future.
There could be other babies that can also grow up to be future Hitlers. So let's say 4 such babies exist. By killing one I eliminated 1/4 for futures with Grown up Hitlers that exist.
This whole thread is getting flagged. Likely by an irrational parent who can't even compute natural selection, babe, and Hitler all in a single paragraph.
>KJ has made medical history. The baby, now 9 ½ months old, became the first patient of any age to have a custom gene-editing treatment, according to his doctors.
This is _not_ the first human to be treated with a treatment under the wide umbrella of gene therapy based on their own edited genes. There probably is a more narrow first here but the technical details get lost in journalism which is a shame.
"Custom" in that this therapy was designed AFTER a specific patient showed a need, and then given to _that_ patient. In most every other context a particular class of disease is known, a drug designed, and then patients sought that have that disease that matches the purpose of the drug.
What's intriguing is not the 'custom' part, but the speed part (which permits it to be custom). Part of what makes CRISPR so powerful is that it can easily be 'adjusted' to work on different sequences based on a quick (DNA) string change - a day or two. Prior custom protein engineering would take minimum of months at full speed to 'adjust'.
That ease of manipulating DNA strings to enable rapid turnaround is similar to the difference between old-school protein based vaccines and the mRNA based vaccines. When you're manipulating 'source code' nucleic acid sequences you can move very quickly compared to manipulating the 'compiled' protein.
I want to say, maybe it's better to say first human under proper IRB/regulatory compliance. Some rogue academic in China tried it a few years ago, if I recall, but with absolutely no oversight and he was pilloried. Also I don't think there is much details about what he actually did...
What the Chinese guy (He) did was completely different. He permanently altered the germline in embryos, which means that every cell in the resulting baby is transformed permanently with the change he made. The work he did violated a wide range of good practice (specifically, the change he made didn't actually work for the goal he desired, and he also ignored all the ethical advice around this experiment, and avoided getting the necessary approvals).
This research is instead a therapy used to treat an already born baby, and it doesn't modify all the cells in the body. Many cells in the body that are transformed by this technique will eventually die and be replaced by clones of stem cells which weren't transformed. I haven't read in detail about whether this therapy targets stem cells, and how long term effective the treatment will be- hepatocytes (liver cells) turn over constantly, so I would expect if the treatment did not affect the hepatocyte stem cells, it would only last ~months and the treatment would have to be repeated.
The major difference is that was a hereditary change. So those changes could now diffuse throughout the species over time. As I recall it was a change that reduces vulnerability to HIV infection.
This is an AI-generated response, and is inaccurate.
That was one of the first cases of _germline_ gene editing using CRISPR - NOT "the first instance of gene editing." There have been quite a few other genetic editing tools that predate CRISPR, and there have been other edits using CRISPR that were not of the entire human's genome.
I wonder if this also affects germline cells so he won't pass the same disease on to his children. If it does, that would be a complete departure from almost all medical treatments we use because most of them are just compensating for the effects of bad genes and leaving them in the gene pool to degrade the health of future generations.
No, it's only in the liver, from what I can tell from the science, not the gametes.
No, it would not depend on the sex of the baby, as the chromosomes that you're editing aren't X or Y.
Evolutionarily, the inheritance of genes is a far slower process than the medical advancements we make, so what I think we're seeing here is a chasing down of the low probability events. In that, most of the evolutionary pressure is coming from things like dirty water and bad food, but as we're solving those low hanging fruit, we have to go to lower probability events to make progress that feels equally important.
Also, if I am wrong here on the answers to the questions, please correct me!
If they could get complete delivery to the liver stem cells, then the change could be permanent, although this is making many simplifications.
Organs in your body usually keep some very old cells (formed in the embryo) around which act as parents for all the new cells in an organ. Any cell can only divide a limited number of times, so they typically maintain a "tree structure" where the old cells create children and grandchildren (etc) that then differentiate into the organ-specific cells that do the actual organ work.
If you modify only the differentiated cells, eventually they die, and are replaced by descendents of stem cells; if those stem cells didn't get modified, their descendents will not have the fix, and the treatment efficacy reduces over time.
That‘s what I was asking: Baby females already have all the eggs they will ever have once they are born, right? Matryoshka doll style. While sperm is always (relatively) fresh.
Speaking as a person whose friend died at 21 from complications related to cystic fibrosis I would like to see these diseases edited out of the germ line.
Is the global gene pool actually degrading though? I only ever hear that in thinly veiled attempts at advocating for eugenicism. And it never comes substantiated by any research.
Anyway, this baby proves we can fix hereditary diseases now.
Good thing RFK pushed out the official overseeing this financing and the current administration is actively defunding the organizations that produced this.
Better to have more disabled or dead babies instead of science.
The current administration doesn't care about kids. They only want you to not terminate a new kid from being born. That they care lots about. What happens after birth is not their concern. Also, I think when they say they want more babies, they want a specific subset of babies to increase.
RFK runs HHS which oversees multiple grant, research, and review organizations in the federal government. This includes the NIH, which has been gutted of experts that don’t share the political ideology of the political arm of the executive and / or aren’t willing to say untruths in service of their political agenda. The news is replete with stories of experts being purged leaving entire areas of research unstaffed; from various cancers to HIV to genetic engineering. Of course the same is true in other areas, such as NOAA, EPA, FEMA, etc that will cause more acute harm. The research harms will play out over decades.
From a purely utilitarian perspective, funding research like this is not an effective use of dollars at the margin. How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking? How many people could we save if we stopped spending money we don't have to do things that the government isn't competent at allocating anyways?
That's not to say the research itself is not impressive nor important, but think critically about the fact that this money doesn't exist in a vacuum.
I think you may be operating under the assumption that the extremely expensive price tag will need to be repeated for each patient.
In reality, as this process becomes more mature it is going to become inexpensive.
The reduction in cost will almost certainly be similar to reduction in cost needed to sequence an individual's genome, which has fallen from tens of millions to hundreds of dollars.
The only catch is that we have to spend money to get there.
Another catch is that the nations who underwrite this research will turn millions in investments into trillions in dividends and the stingy or poor will be left in the cold.
Seeing that private enterprise is only good at taking publicly-funded work and patenting it, and that in the absence of public funding nothing ever gets invented, we should be all-in on this.
edit: it's apropos that you mentioned obesity because GLP-1 drugs are the direct, irrefutable, product of spending at government labs.
edit2: specifically, a single government scientist playing around with lizard saliva in the 1970s because he thought it was interesting.
I'm of accord with the Utopians of Ada Palmer's Too Like the Lightning:
When a Utopian dies, of anything, the cause is marked and not forgotten until solved. A fall? They rebuild the site to make it safe. A criminal? They do not rest until he is rendered harmless. An illness? It is researched until cured, regardless of the time, the cost, over generations if need be. A car crash? They create their separate system, slower, less efficient, costing hours, but which has never cost a single life. Even for suicide they track the cause, and so, patiently, blade by blade, disarm Death. Death, of course, has many weapons, and, if they have deprived him of a hundred million, he still has enough at hand to keep them mortal. For now.
>There's no evidence to support that gene therapy will ever be inexpensive.
My prediction is based on the number of efforts, too numerous to list here, being undertaken to develop lab equipment to automate the extremely labor-intensive workflow and the accumulation of vast libraries of CRISPR-Cas9 screens and dependency maps, the creation of which are also expensive and labor-intensive.
There are known DNA changes that would probably help all people with chronic diseases, but it's ethically more accepted to go for the more fatal diseases and cleaner cases first, like a rare mutation with a high fix rate.
Yes, but the cures here aren't general. They're highly specific, and the rare conditions have a long tail- large numbers of different conditions, each with a very small population of affected individuals, and likely, the treatments will be somewhat customized for each type of disease.
See my comment above. Getting approval for rare diseases and expanding the indication to the common form of the disease is a well established strategy in pharma.
Also rare genetic diseases give insight into the underlying mechanisms and pathology of common sporadic diseases, which can be leveraged to develop new and better therapies.
Getting a new drug or therapy approved for a rare form of a disease and then expanding the indication to the common disease patient population is a well established strategy.
Given the admin’s propensity for cutting spending on research like this and other domestic interests while ratcheting up military spending I think that poster’s point stands.
That is not comparable at all. To save people from obesity, smoking and drinking, you don't need more resources on fundamental research. You need different education, and socio-economical programs, possibly even less funds on the overall: if no resources is spent anymore in promoting bad habits, you end up with more financial resources and a healthier population.
Instead if no resources is allocated on developing all the technical requirements to do such a thing, humanity ends up with less tools to heal itself, and that's it.
a) that statement above has nothing to do with RFK
b) the whole point of NIH and other government research funds is to pay for this sort of "not clearly an effective use of dollars" type of research that Pfizer et al won't touch. but you can look at a ton of future applications from this - lipid packaging, CRISPR methods, drug delivery, etc that had to be devised, and could conceivably be commercially viable if the methodology is perfected and the cost comes down.
It's not even that. Utilitarian premises still let a very broad set of perspective. A long term perspective on large humanity won't lead to same conclusion as what will be the most joy inducing experiences in the next 24h for the 1% wealthiest people in the world right now.
How do you know it's not effective? The cost per life saved is extremely high now, but this stuff gets better over time. How much did penicillin cost to produce originally?
And yet, the first patient treated with mass-produced penicillin used half the total supply, and the stuff was so rare that it was extracted from patients' urine for reuse.
I’ve thought about this recently as well and I don’t know if I have a fully developed view. What is the moral responsibility of all people to pay for medical research or operations that would affect a small number of people. Is it ethical to compel others to pay for the research deemed valuable by some, but not by others. Who is the arbiter of that research’s value?
I could say I believe the government should fund research into fixing people who think cilantro tastes like soap because for most of us it is delicious and promotes healthy diets. Should I be able to compel (tax) you to pay for that research?
Where that line is drawn will always be wrong to someone. How research is prioritized will always be wrong to someone. Is there an ethical way to determine the best use of collective resources and what portion of one’s property must be taken from them to fund that research.
> How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking?
How confident are you the answer isn't very close to zero? We've already curtailed smoking quite a bit in the past 30 years. At the level of an individual, it isn't any particular mystery how to stop obesity or to simply not drink, but population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains. Throwing more money at the problem doesn't seem like it would obviously change that.
Also keep in mind that overeating and alcohol addiction have significant genetic components. Research into gene editing has the eventual potential to cure damn near any disease, including whatever pet causes you personally think are worth defeating.
>population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains
Said like that it paints things like there are not far more resources spent on propagating the bad habits (as some ROI is expected from this by some actors), and any attempt to put a social health program in history always ended in major catastrophes.
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.
That is one of the most incredible things I have ever read.
One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But, the RNA -> Protein equipment will just make protiens it without any problems.
Which, yeah, that's a miraculous discovery. And it was well worth the 2023 Nobel in Medicine.
Like, the whole system for gene editing in vivo that we've developed is just crazy little discovery after crazy little discovery. It's all sooooo freakin' cool.
https://en.wikipedia.org/wiki/Pseudouridine
I remember from a few few years back that the lipid coating may have caused problems for the liver, when treating people for diseases that needed to target a lot of tissue, such as muscle disorders. Is that still the case?
Unfortunately, I do not know. Sorry here.
If anyone else does know, please chime in!
I suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect.
That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports.
That's bad if your goals are to detect genetically modified people and discriminate against them.
I see a near future where the kind of people who loathe things like vaccines and genuinely believe that vaccines can spread illness to the non-vaccinated feel the same way about other things like genetic modification and use legal mechanisms to discriminate and persecute people who are genetically modified.
> it will make people who are genetically modified in this fashion trivial to detect.
I'm not totally sure. If I understand it correctly, the mRNA contains pseudouridine, and it makes the protein that will edit the DNA. The edited DNA should look like a normal one.
Ah. That makes sense. My mistake.
I'm less interested in detecting genetic modification for the purposes of discrimination than making sure it's available to everyone.
Assuming requisite safety of course.
I'm more concerned about the possible negative unintended consequences of making it available to everyone first. Genetic modification is well-explored Pandora's Box in science fiction and present humanity seems so ill-equipped in collective philosophy and reason to handle a paradigm shift of that magnitude.
Don't be silly, the rich will want their babies to be perfect so gene editing will be legal and considered OK.
Can you explain why this is a bad thing, or is it just “”the rich” bad”?
Not OP, but presumably it's because it could cement a permanent divide between classes. We still have quite a bit of upward mobility in the US, but health is a tremendous predictor of future outcomes, so gating that to the rich is dangerous to the stability of society in that way.
If you're going to make the comparison with vaccines, and if history is any indication, the more realistic worry would be the other way around (since that's where the money is): that genetic modifications will be mandated, and that those who object will be discriminated against.
[And no, I am not anti-vax, nor anti-gene-editing.]
“What do you mean you haven’t modified your chromosome 7 CFTR gene? And you’re planning to have children???”
I don't know anything about gene editing, but my grandmother was a carrier of the BRCA mutation. It would have saved a lot of heartbreak in my family if that could have been detected and repaired. My aunt, mom, and brother (age 4) all died of cancer. I'm just glad that my mom didn't know she had the mutation and passed it on to her child.
It wouldn’t be crazy if I teleported 50 years in the future and heard someone tell me that not doing this is akin to child abuse. Obviously all suffering is relative, etc. etc., but it’s just interesting to imagine a world where the societal pressure to make a perfect child is high.
Careful with qualifiers there. I genuinely believe that vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented. For example, it's why only the inactivated (aka "dead" virus) polio vaccine has been used in the US since 2000.
I'm not arguing about whether the risks of the attenuated virus outweigh the benefits. I think the data are very clear there. (Heh -- and I'm sure the vast majority of people will agree with that statement, even if they disagree on what the clear answer is....)
It's just that one shouldn't mock a belief without including the necessary qualifiers, as otherwise you're setting up an argument that can be invalidated by being shown to be factually incorrect.
As for genetic modification of humans, IMO there are a lot of very good reasons to be wary, most of them social. Fatal hereditary conditions are obviously an easy call. What about autism (not saying there's a genetic link there to use, just a what if)? Or other neurodivergence? Like being a troublemaker in class? Or voting for the party that doesn't control the medical incentive structure? Heck, let's stick with the fatal hereditary conditions, and say the editing does not affect germ cells. Is it ok if the human race gradually becomes dependent on gene editing to produce viable offspring? Or let's say it does extend to germ cells. The population with resources becomes genetically superior (eg in the sense of natural lifespan and lower medical costs) to those without, creating a solid scientific rationale for eugenics. Think of it as redlining carved into our blood.
I don't think discrimination against the genetically modified is the only potential problem here.
As humans, we'll deal with these problems the way we've dealt with everything else transformational. Namely: very, very badly.
At one time organ transplants were considered an ethical grey area (perhaps they still are by some), but I think most people now would consider it better to save lives in such a manner when it only brings help to those who need it and it's possible to, compared to the alternative. Having the capability may mean that things like organ theft now exist, but the benefits around the world outweigh the nastiness that has always come as part of human nature.
I mean, I feel like autism is a terrible example here, it's not just some quirky personality trait, it's a reality people live with that runs the gamut from difficult to completely debilitating. Even the more mild forms of autism cause extreme difficulty in many aspects of life. If that was curable or preventable, that'd be great.
If it turns out some pathogen or chemical made me autistic, regardless of whether or not I could be cured as an adult, I'd have certainly preferred to live the reality where I had been as a child.
I think a better reason autism is a bad example is that part of its definition is that it is a consequence of fundamental brain structure and development (differentiating it from other psychological disorders which are acquired and more malleable). These aren't things you will "undo" with some gene edits. The whole brain has developed in a different way. Short of re-growing them a new brain you aren't going to change that (assuming you wanted to).
I think scientists have believed for a while that any type of “autism cure” would need to be extremely early intervention for maximum effectiveness for exactly this reason. I remember speaking with a team that was studying detection of autism in the womb for this exact reason.
Sure, the purpose was to illustrate a slippery slope, and curing autism is meant to be more obviously good than abolishing all forms of neurodivergence but less obviously good than fixing fatal hereditary diseases.
I'm not going to claim that I know the perfect place to draw the line.
>...and say the editing does not affect germ cells.
To me the wildest scenarios take this off the table.
> vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented
Nothing in medicine is certain. Nearly any medical treatment has a small chance it could kill you. There’s a small, but non-zero chance of a lethal infection even if they injected you with saline, odds that rise dramatically in less than sanitary conditions.
Ironically the use of the attenuated oral vaccine for polio was because of the risk of infection in places where the availability of sterile syringes was hard to guarantee. It’s all about the relative odds.
> [...] then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous
Please tell me there are measures to prevent this going into the wild. Please tell me this won't be used in large-scale industrial farming.
Yeah, it's not a drama.
The reason that the body doesn't alarm as much to Pseudouridine, is that it's not a 'natural' RNA base. Meaning that, for the most part, nature really never uses it and so we haven't evolved to look out for it. Nature uses Uridine and so immune systems have evolved to look out for random bits of RNA in the body that use it and then clean that all up.
It's like if you're looking to clean up legos in you house with a romba that only cleans up legos. And all of a sudden it finds a duplo. It's going to take a hot second to figure out what to do with the duplo. And in that time, you can sneak by and build a duplo fort. (Look, I know this analogy is bad, but it's the best I can come up with on the fly, sorry. If anyone else wnats to come up with a better one, please do!).
The Pseudouridine is used up and degraded very quickly inside the cell, minutes at the very very longest, more like microseconds. It's just part of a messenger (the 'm' in 'mRNA') to tell the cell to do things.
You might see mRNA gene editing in factory farms, but it would just be easier to do germline editing instead and skip spraying animals, plants, and fungi. Why waste the equipment, right?
I thought the analogy was good. They’re meant to be simple and easy to understand, not perfect representations.
Why would it be used in farming, you can edit the DNA before fertilization in farming, no need to do anything in vivo.
As I understand it, there is nothing in nature that can create it, so the mRNA can never be accidentally replicated. It’s a safety mechanism that prevents escape.
Industrial farming of what?
Farming? This will be used in warfare.
That would be less effective than bio and chemical weapons are. Which are not used because they just suck
I’m not sure of by “they just suck” you meant to imply that they’re ineffective. If that’s the case, I strongly disagree. They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific. Nobody wants it used on them, so nobody uses it on anyone else.
I cannot imagine a more effective weapon than an invisible gas that melts you alive, and there are MANY chemical and bio examples of these types of weapons.
>> They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific
That’s the story but it doesn’t hold up. Chemical weapons were used as recently as the Syrian civil war. I also think if they were really effective in modern warfare, Russia would have long ago deployed them in Ukraine.
More here: https://acoup.blog/2020/03/20/collections-why-dont-we-use-ch...
The ceiling for the destruction caused by biological weapons is far greater than chemical weapons. There is no chemical weapon that can hijack the victim to make more of it.
Not under the current way we do things, I don't imagine.
So the real trick here isn't the mRNA, it's the nanobubbles. Basically, you're putting these bits of mRNA into these little fat bubbles and then injecting those into the blood. Making those bubble shelf stable is really hard, hence the issues with temperature and the covid vaccine. To then make those little fat bubbles stable-ish in the blood is also a really hard thing to do. They have to get to the right places (in this baby's case, the liver) and then degrade there, drop off the mRNA, and not mess up other tissues all that much. Like, it's not terrible to make these micelles degrade in vivo, but to have them do that and not degrade in the tubes, ... wow... that is really difficult. There's a reason that Moderna is so highly valued, and it's these bubbles.
To try to then put these in a weapon that could do this though the airways would be, like, nearly impossible. Like, as in I think the second law of thermodynamics, let alone biology, and then simple industrial countermeasure like a N95 respirator, yeah, I think all of that makes it pretty much impossible to weaponize.
(Hedging my bets here: I don't know if they had to do all that with this baby, as you can kinda go from lab to baby really fast, since it's such a special case. But for mRNA based vaccines and cancer treatments, you have to deal with the shelf stable issue)
(Also, other bio people, yes, I am trying to explain to laymen here. Please chime in and tell me how I'm wrong here)
I think it doesn't need to be a direct weapon to be used in warfare. You can genetically modify your own military.
Yeah good point!
Something that a lot of people are unaware of is that US Military is allowed to do this. I forget the exact EO, but it was signed by Clinton and is in the 12333 chain of EOs. Mostly, this is used for the Anthrax vaccine. But, it does give clearance to do other forms of medical experimentation on warfighters.
No, really, I am serious here. This is true. I may have the details a bit off, so sorry there, but they can and do preform medical experiments on people without their consent. Now, to be fair, France does this too. They do sham surgeries over there. Non-consenting human medical experimentation is quite the rabbit-hole.
So, I can kinda see in the next 10 years, certainly the next 50, a routine shot given to warfighters to help them with things like blood loss, or vitamin C production, or fast twitch muscles, or whatever. The legal framework is already there and has been for a while, it's just an efficacy issue, honestly.
Is this a troll? Pseudouridine mRNA isn't gene editing.
What do you mean? Is mRNA not used to produce the enzyme that these comments mentioned? I don't think they were saying mRNA is gene editing itself. Just commenting on a modified mRNA helping the process compared to normal mRNA. Might be misunderstanding though so correct me if I am
I dunno, I think they are being sloppy and conflating things. We can induce manufacture of proteins and can design proteins that carry out gene editing, so we can stack that knowledge together to induce cells to manufacture proteins that carry out gene edits, but it's the payload that is the gene editing, not the instruction to make the protein.
Given the merry movement to call the COVID vaccines gene editing, it rankles.
Hey, yeah, I'm not the most up to date on the current methods. Most of my knowhow is a bit out of date here. So thanks for piping up to correct things.
Do you know of any good resources that I can use to get up to speed on the exact methods they used for the baby?
My understanding, outdated as it is, is that we're using the mRNA to go in and create CRISPR-CAS9 slicers/dicers and additionally to that, the correct genes (not mRNA) to get stitched in. I would love to know more about how I am wrong here, as I am sure I'm not even close to really understanding it.
Thanks!
> That is one of the most incredible things I have ever read.
This is even more great reading behind the above:
https://en.wikipedia.org/wiki/Jennifer_Doudna
A rare case where the list of awards she's received is so long it needs a separate Wikipedia page https://en.wikipedia.org/wiki/List_of_awards_and_honors_rece...
[flagged]
I assign only the most nefarious motives to those clowns, but at least her govt profile is intact:
https://www.lbl.gov/people/excellence/nobelists/jennifer-dou...
The fact that this treatment "built on decades of federally funded research" is the scary part, given that such funding may disappear.
This seems like a non sequitur.
Walter Isaacson's book "The Code Breaker" is about this subject. I couldn't put it down.
All his books are like that. The Innovators is my personal favorite.
Also
https://en.m.wikipedia.org/wiki/Emmanuelle_Charpentier
She's got a couple of great appearances on RadioLab.
Cue the book "The Code Breaker" [0]. I read it a long time ago and such an incredible book and journey by Jennifer Doudna and Emmanuel Charpentier. Do check it out
https://en.wikipedia.org/wiki/The_Code_Breaker
I literally said the same thing out loud.
I had heard about CRISPR a while back but most reporting on it kind of hand waved over the mechanisms of how it actually accomplishes its work. What these researchers have figured out to make this work absolutely blows my mind.
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene.
This isnt entirely unlike the method mRNA vaccines use. Through some clever biochemistry, mRNA vaccines get bits of code into cells where the cell's built in code compilers manufacture proteins that induce immunity.
We have developed software patches for our biology.
How does it know how to gps around? From what I know everything down there is a chemical reaction with some minimal physical motion, but how do you program it to know where to change and what and how.
It doesn’t know anything about where it “needs” to go. One of the weirder and more unintuitive things about molecular biology is just how fast everything moves inside a cell. The CRISPR molecule diffuses from one side of the nucleus to the other in a couple seconds and probably bumps into the entirety of the genome in a matter of minutes or hours. It’s very, very crowded inside cells, proteins and DNA and metabolites are constantly bumping into each other and are tumbling around at frankly incomprehensible rates. So, nothing needs to “know” where it needs to go, it simply gets pushed and jostled around until arrives there and then the attraction between the CRISPR’s RNA and the DNA takes over
It’s more like a “ctrl+F” for DNA. Hopefully there’s only 1 match (the target site).
So you create a molecule that binds to a certain location in the dna, and then deploy a billion of them?
Add gene has a great guide as to what goes on at the molecular level: https://www.addgene.org/guides/crispr/
Essentially you can design an rna molecular that contains a 20 nucleotide long sequence that can target your region of interest, with the caveat that there is a standard recognition sequence proximal to your sequence of interest (PAM sequence)
Gene therapies are pretty incredible. Some of them are still making a button-hole with a machete, but that's relative to the previous medical intervention of a button-hole with a tank's main gun.
One of the treatments for sickle-cell involves switching off the gene that makes the malfunctioning red blood cells, but of course that's not sufficient; you'd stop making red blood cells completely and you'd die. So it's combined with a modification that switches on a gene that all humans express pre-birth that causes your body to make "super-blood": red blood cells with significantly more binding points for oxygen. This is necessary because a fetus gets oxygen from its mother's blood, so the increased binding affinity is useful for pulling the oxygen towards the fetus at the placental interface. After birth, expression of that gene is disabled and regular RBC genes switch on.
So the therapy doesn't "fix" sickle RBCs; it disables the body's ability to make them and re-enables fetal RBCs! I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant, I imagine increased-affinity RBC could help for athletics... But I also imagine it requires more iron to generate them so has dietary impact).
High affinity RBCs would actually be a disadvantage for athletics. You actually don't need very high affinity to pick up oxygen from the lungs -- your lungs are comparatively extremely high in oxygen. What matters more is being able to drop the oxygen off in peripheral tissues. Higher affinity means that it's harder to actually deliver the oxygen, which is why we evolutionarily developed the switch away from fetal hemoglobin.
I have natural persistence of fetal hemoglobin which counteracts my inherited thalassemia trait.
No problems really..never knew I had it until I was told I had thalassemia trait as part of genetic testing. My hemoglobin panel shows fetal hemoglobin.
Made it sound like it's a computer, is it Turing complete?
It's fundamentally different than a computer and arguably more complete.
The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem
This is crazier: https://www.sciencealert.com/are-we-all-quantum-computers-wi...
About CRISP, it's like the ultimate Perl+Regex for the body.
If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.
Hilarity subsequently ensues.
Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)
Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.
Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.
Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).
True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.
Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
Made me think of
from https://jsomers.net/i-should-have-loved-biology/>> Imagine a flashy spaceship
I misread this as "fleshy" for a moment, and the quote almost works better that way.
I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
Sounds kind of like the infinite tape machine....
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.
I know someone well who works in this space, personalized gene therapy as cancer treatment.
> until it finds the exact DNA letter that needs to be changed.
This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details.
To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.
The approach they used which is base editing doesn’t actually insert or remove DNA, it actually uses an enzyme to convert one base to another, which is much safer as this doesn’t require a double strand break in DNA: https://blog.addgene.org/single-base-editing-with-crispr
That is interesting, I didn't catch the difference my first time through the article.
I do still question their claim of 100% precise results though. At least based on that high level description I can definitely see it being safer, but I question any scientific claim that is an absolute.
Specific to the editing vs insertion mechanism, I question how it doesn't run into similar constraints where the mechanics of targeting exact portions of the DNA can occasionally miss or impact the wrong segment of DNA entirely.
I haven't dug as deeply down the base pair conversion though, so I could absolutely be wrong!
Never bet against science !
Running this article through GPT and asking it more questions is one of the most incredible allocations of productivity I have ever seen
Yep, this is truly incredible!
If someone in the year 2050 was to pick out the most important news article from 2025, I won't be surprised if they choose this one.
For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body.
We still are struggling in most cases with how to deliver the DNA update instructions into the body. But given the pace of change in this space, I expect massive improvements with this update process over time.
Combined with AI to better understand the genome, this is going to be a crazy century.
Further reading on related topics:
https://www.lesswrong.com/posts/JEhW3HDMKzekDShva/significan...
https://www.lesswrong.com/posts/DfrSZaf3JC8vJdbZL/how-to-mak...
https://www.lesswrong.com/posts/yT22RcWrxZcXyGjsA/how-to-hav...
The “How to make superbabies” article demonstrates a couple of fundamental misunderstandings about genetics that make me think the authors don’t know what they’re talking about at a basic level. Zero mention of linkage disequilibrium. Zero mention of epistasis. Unquestioned assumptions of linear genotype-phenotype relationships for IQ. Seriously, the projections in their graphs into “danger zone” made me laugh out loud. This is elementary stuff that theyre missing but the entire essay is so shot through with hubris that I don’t think they’re capable of recognizing that.
The EA community is generally incapable of self-awareness. The academic-but-totally-misinformed tone is comparable to reading LLM output. I've stopped trying to correct them, it's too much work on my part and not enough on theirs.
What does EA means here ?
"Effective Altruism", something I find myself aligned with but not to the extremes taken by others.
Is all the DNA in the liver different, or just a percentage of the cells?
the usual next questions will be:
- how further can we push this to make the best, most optimized human?
- what are moral implication of this?
- what are the side effects / downsides?
Are there any age restrictions?
That's all very cool, but there are also articles like this one: https://www.theguardian.com/us-news/2025/feb/20/trump-nih-cu... - I'm not able to read the Times article because it's paywalled, but as other commenters have mentioned, this research was funded by the NIH, which the Trump administration is currently in the process of defunding. So, if further progress along this road will be made, it'll probably be much slower and less likely to be in the US.
As a father, the idea of being told my 1 week old baby is going to die would be my worst nightmare. The fact these doctors and scientists saved this childs life is a monument to modern medical science. This is absolutely insane. Hopefully the child doesnt need a liver transplant, but this is a great leap forward.
[flagged]
What an insanely callous and shallow take. I don’t even know where to start. You’re trying to claim the moral high ground by complaining that a privileged child didn’t suffer and die? Do you even understand the point of reducing poverty?
An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer.
How many people can even afford to get multiple opinions for a weird lump on their back? Or go to the dentist for a strange toothache? How many people can afford to get consistent exercise and eat healthy? How many lives would be saved or at least massively bettered? We already have the means to extend the life expectancy of the average person, and it's not being used. Obviously this is a wonderful medical advance, but it's depressing to wonder who it's for.
So obviously we should not be excited about it? Lose me with that noise.
Do point out where that was said, and I will be happy to correct it! It's important to have nuanced opinions and discussions about things.
> An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer.
I'm as negative about the rich and powerful as anyone but this is such a cynical take - that might have been applied to many medical treatments in the past that have become relatively commonplace and easily accessible to people of all classes, at least in sane countries with sane healthcare systems.
Indeed, my view is heavily American-centric. And the trends of the past-- which you're right about-- may not apply to the future given increasing wealth inequality, the cost-of-living crisis, and the climate crisis (for which undoubtedly the poorest of us will be forced to shoulder most of the burden).
I'm explicitly not saying this work shouldn't be done, it should! But it does not exist in a vacuum, and it would be silly to pretend that it is not colored by vastly unequal access to modern healthcare. The reason I get excited about technology is because of the potential it holds for making us all happier and freer to do the things we like for longer. We are lost if we do not at least speak about the thunderclouds on the horizon for this philosophy of technology.
> We are lost if we do not at least speak about the thunderclouds on the horizon for this philosophy of technology.
I think, every once in a while, it's okay to just celebrate without looking for the the clouds :)
That's fair, I respect that view. :)
[flagged]
Certainly, you may choose to conduct yourself like this. I won't stop you! And other people who might've otherwise seen your point will be turned away from it. I prefer to have constructive conversations with people I view as equals, not stupid or infantile.
Observe that the replies to my post do engage with the argument I made.
[flagged]
[flagged]
This question is logically sensible but considered emotionally abhorrent. If you haven't been tested for autism you should consider taking a quiz.
Only 1% of the population has autism. Presenting autism as a considerable possibility for trollish behavior isn't much different than what the parent commenter did.
"questions I don't want to think about are trollish"
[flagged]
If you dont see the fundamental difference between a one week old baby dying and a 70 year old dying, you are beteft of humanity. One is a baby, one that is completely new to the world and totally innocent. The other is a person that has lives life and experienced life.
Please stop with the ad personam. Can you explain how this relates to my question (and you could answer it as well)? Also, is death of an older person worth less grievance?
The medical profession allocates scarce resources based on the amount of quality-adjusted life years it will bring.
Humans see value in living life, so cutting a life short is worse than a life that would be ending soon anyway.
A parent's obligation is to try and do everything they can to make their child's life good. I think most people would agree that living more than a week is a good thing.
Yes. Yes it is.
> that the child will die at some point
So what? So a father shouldn't celebrate medical advances that mean their kid doesn't have to die after a week? And if it does, they should just be like "Ah, that's life!"
I never said any of this
I didn't say you did. I was trying to understand your point, and so was inferring what you could possibly have meant with your original comment.
Oh, sorry. I definitely think a father can (should?) celebrate medical advancements like this, and definitely shouldn't undermine death like "Ah, that's life". My point is that people often worry about their children's death when they themselves are still alive. Death seems okay if it's when they don't get to see it
Hopefully after living a long and fulfilling life? Geez
Edgy! No one has ever considered the mortality of their children ever, or contemplated the difference between death before and after the realization of potential. Wow!
Genuinely don't know why this is edgy. I was trying to understand his logic
Having a child predecease you is one of the worst things that can happen to a person in general. This is a common sentiment in humans. The strange thing is that you mentioned you're trying to follow "logic." This is not logic. These are emotions.
I understand this. My question arose from the fact that it seems like he only cares about the child dying before him, not the child's death overall. It was
> the idea of being told my 1 week old baby is going to die
not
> the idea of my child dying
"I am simply a machine. I do not experience death as humans do. It is just a cessation of function." - Data in Star Trek The Next Generation,
Not only a hurtful question, but a stupid one as well. Well done.
Care to explain why it is stupid? And what's hurtful about it, too? Deciding on a child, you KNOW it's going to day at some point
I don't really know what you're going on about? We're all going to die, we all know that that's going to happen, but none of us want to suffer and most of us would like to live relatively long lives.
I am not a parent but I think if I did have a kid I would try everything I could to keep my child alive and minimize pain in my child's life.
Typically yes? But surviving infancy is the first step on the road to immortality (but that will require more than CRISPR... probably?)
Immortality? (rolleyes)
If you're being pedantic, babies usually never die - they transform into an adult which is the form that dies.
bro read the room
[flagged]
In real life, anyone who is a parent knows you would welcome a better chance for your child without hesitation
Delete your comment. You're minimising the death of children.
Yeah I'm sensitive about this. I like many other parents of children who have been lost to genetic disease have good reason to be.
We can pause and acknowledge that life (and what that means) will change, while also acknowledging that for many it will be the easiest decision in the world for it to change.
When my second son was born and was just so very tiny some genetic test came out questionable. We were very strongly encouraged to go to Childrens hospital ASAP to get more tests. He handled it well, being just a few weeks old. The tests came with "he's a carrier of something obscure but nothing to worry about", so it's all forgotten.
Three interesting thing come out of it from me. First, I was on Microsoft insurance which was quite gold plated at a time, a blessing only obvious in rear-view mirror, because Childrens was quite excited to continue any number of tests. Second, the technology of all this is absolutely amazing and I am so happy that it was available to me, and it has likely gotten better. Three, I want that tech to continue to expand and current destruction up there is going to hand this torch to someone else, which makes me sad.
> I was on Microsoft insurance which was quite gold plated at a time
One of the biggest perks of working for Microsoft for a long time was their health coverage. I can't tell you the number of times I'd be doing initial paperwork for a doctor's appointment and the receptionist would be like, "Oh you have THAT insurance, we're going to do all of the tests." I've heard they since cut back on it a little, but it truly was gold plated.
Circa 2005, Stanford FTEs had nine (9) health insurance plan choices. ;P
My niece in Australia has a rare genetic disorder and when my wife and I had our first baby in California a few years ago we were concerned about that. We also had fantastic insurance and the hospital team there did a test where they took a blood sample from my wife and seperated the childs DNA from the mothers in the blood sample and tested it for several genetic disorders. That test is not available in Australia even today.
> That test is not available in Australia even today.
Pretty much every lab test is available in Australia if you are willing to pay for it; if they don’t have a local lab capable of running the test, they’ll send the sample overseas
The real question is whether it is covered by insurance or not, and a lot of the time the answer is “no” - I recently forked out over US$500 for genetic tests on one of our kids (which the paediatrician recommended), although the results weren’t particularly helpful (“rare variant of uncertain clinical significance”)
Incredibly that test (cell-free fetal DNA - cfDNA) is now standard in California, to the point where most expecting parents in California now learn the baby’s gender super early. We learned our baby’s gender only 10 weeks into pregnancy because of the cfDNA test.
Research funded by the NIH which our government is actively gutting
Yep, this effort is the culmination of 50 years of research. Could be the last harrah of the NIH with the amount of cuts we've had and the scientists who are taking jobs in other countries.
Unfortunately a staggering amount of research in other countries is largely funded by the NIH/USA.
How so?
And so what?
That means that it's not going to happen anymore.
Unless those other countries step up and fund it themselves.
They might. They might not.
Not to mention the long arcs of the careers of scientists and support staff involved in this breakthrough, who were also supported by federally funded research grants.
Interesting view as many people were so anti-MRNA vaccine because "it was created too fast" oblivious to the years/decades of study in that field that allowed for that "too fast" to happen.
I guess it's still too early in this story's news cycle for the people with anti-views to be making noise yet. No GMOs, but human gene modification is okay. No cloning either. The boogeyman is gonna get us no matter what we do
As the father of a 5 year old boy with a genetic degenerative muscular disease whose lifespan will depend directly on how fast these technologies progress, I have difficulty responding in a civilized manner to the pointless, cruel, and stupid actions of the Administration in this regard. Rage is the word.
It is breathtaking to consider how the members of the Administration and their children, parents, and grandparents have benefited from NIH-funded research in innumerable ways that they are shamefully unaware of, every time they visit the doctor or the ER.
I have the same rage. But it extends equally to those who voted them in and donated to their campaigns, including my own family members.
They have created a huge rift in this country and I am still trying to figure out if I will forgive my family members and what they'd have to do to set us on a path towards reconciliation.
When there's a contract in place to conduct pediatric cancer research, and the government decides one day to break that contract, and it takes courts to rectify the situation, and then the government defies the courts, and the voters are cheering on the illegal actions of the politicians, well, rage is a mild word for what I feel.
Government? Republicans. Republicans are the ones fighting against government funded research. Let’s put blame where blame belongs.
The Secretary of Health and Human Services is a conspiracist that doesn't believe in vaccines and swims in sewers with his toddler to prove a point about "natural immunity" [1]. The new Surgeon General prayed to the stars and the trees and took mushrooms to "get ready for partnership" [2]. This is the party of so-called "rationalists".
Fascism has a long history of rejecting rationalism and science, and of embrassing esotericism [3]. Something our representation of nazis in media did a terrible job at conveying. We always see nazis as cold, calculating and rational when they are anything but.
[1] https://www.nytimes.com/2025/05/12/us/politics/rfk-jr-rock-c...
[2] https://www.pbs.org/newshour/health/trumps-new-surgeon-gener...
[3] https://en.wikipedia.org/wiki/Occultism_in_Nazism
> Something our representation of nazis in media did a terrible job at conveying.
Indiana Jones and Hellboy are pretty explicit about this.
> But KJ’s treatment — which built on decades of federally funded research — offers a new path for companies to develop personalized treatments without going through years of expensive development and testing.
Really incredible story and I'd love to know the process for receiving this, for example FDA approval etc. It's nice to see such in-your-face results from Federal funding programs. Without being political, it's sometimes hard for regular people to appreciate just how much good actually comes out of Federal Funding. There was another thread where someone even said something along the lines of : "Well during war things get done faster" . This simply isn't true. It might be done louder but Federal Funding never stopped pushing things forward.
Now imagine DOGE team of experts cutting this a couple of years ago
Here's the thing - likely few would have noticed. We are structurally blind to the places in which public investment would have made our lives better, especially when they are things like scientific research that the vast majority never think about until it produces results.
I didn't want to bring up specifics but I'd be lying if it wasn't on my mind.
I mean, the article is explicitly written to put it on your mind:
"The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services."
"But KJ’s treatment — which built on decades of federally funded research"
"The result “is a triumph for the American peoples’ investment in biomedical research,” Dr. Urnov said."
"The researchers emphasized the role government funding played in the development."
"The work, they said, began decades ago with federal funding for basic research on bacterial immune systems. That led eventually, with more federal support, to the discovery of CRISPR. Federal investment in sequencing the human genome made it possible to identify KJ’s mutation. U.S. funding supported Dr. Liu’s lab and its editing discovery. A federal program to study gene editing supported Dr. Musunuru’s research. Going along in parallel was federally funded work that led to an understanding of KJ’s disease."
"“I don’t think this could have happened in any country other than the U.S.,” Dr. Urnov said."
This is an article about federal funding of medical research with a cute baby as the human interest bit.
It would probably be good if more of us brought up specifics more often.
It would be nice, but you know how politics can usually turn into a bit of a toxic environment online. That said, I personally don't see the DOGE thing as anything other than a way to reduce the power of regulatory enforcement. I'm sure someone who would want that would never be conflicted with interests there...
I'm not an expert, but I have learned that FDA approval is not actually necessary for treatments and drugs. Your doctor has a lot of leeway when it comes to treatment but she of course experiences more risk of accusations of malpractice when prescribing off label drugs or unapproved treatments. insurance will also rarely cover treatment that is not FDA approved. the requirement for FDA approval generally has more to do with your legal ability to market the drug, treatment, or product.
That's actually super interesting and kinda great to hear, I guess my follow up question is obvious but would insurance companies cover that kind of procedure in the US? I get the impression it wouldn't be.. but if out of pocket.. I know I'd absolutely do anything for my kid.
Detailed New England Journal of Medicine article about this case: https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
And an Editorial piece (more technical than the NYT): https://www.nejm.org/doi/full/10.1056/NEJMe2505721
One of the authors: Julia L Hacker
Did you mean to post the same link for both?
thanks for this, I think all these lay articles on biomedical news should definitely be accompanied by the paper
I always try but way more often than not the paper is paywalled.
https://archive.ph/VNYzA
[flagged]
My experience is quite the opposite - I'm actually thinking about subscribing to the NYT (again) or The Atlantic (despite their higher cost) purely for the quality of their writing.
What part of the article are you referring to?
You complain about oversimplification, then in the same breath complain about "random political stuff" being included. How is that not hypocritical, at best? This medical breakthrough would literally have not been possible without "politics". Get your head out of the sand. No one should be able to escape learning how their politics affects them or the society they are a part of. And if you want to enjoy the benefits of that society, then you don't get to complain about being reminded of how those benefits were achieved.
Pandering to people's fragile political sensibilities is how the U.S. got to this point where millions of citizens voted against their own self-interest because they thought candidates running on anti-intellectual, anti-science platforms was worth the zero sum "win".
Enjoy your weekends, eight hour workdays, clean air, and clean water—whether you like that those were all political or not!
NYT isn’t super specific here, but they made it sound like the disease treated is liver related. My understanding is that the liver is a good place to start with CRISPR-type gene treatments, in that the liver normally deals with anomalous shit in your bloodstream, say, like CRISPR type edits. So anywhere outside the liver is going to be significantly harder to get really broad uptake of gene edits.
It’s crazy encouraging that this worked out for this kid, and I’m somewhat shocked this treatment was approved in the US - I don’t think of us as very aggressive in areas like this. But to me, really hopeful and interesting.
You are right, current CRISPR systems tends to accumulate in the liver. Most CRISPR companies have shifted their focus to the liver over time because it's easiest to deliver there. Most viruses people use to target other organs are not large enough to carry CRISPR and lipid nanoparticles with CRISPR seem to like ending up in the liver and are hard to deliver at dose to hit other organ systems. It has been one of the big struggles of CRISPR companies. That being said, this is a huge deal and very encouraging.
As to the FDA stance, it tends to be more willing to go ahead with compassionate uses like this when it's clearly life or death.[1]
[1] https://www.statnews.com/2025/05/15/crispr-gene-editing-land... This discuss a little of the FDA stuff but not much more detail, it sounds like they did let them skip some testing.
It is caused by a missing enzyme in the liver, yes.
Specifically it is this: https://en.wikipedia.org/wiki/Carbamoyl_phosphate_synthetase...
People born with this lack the enzyme CPS1, which screws up the urea cycle and causes a build up of ammonia. Ammonia build up is bad for your nervous system.
I don't think it's gonna be that hard. All cells that blood reaches were happily taking mRNA vaccine.
I hate to break it to you, but it will be substantially more difficult to target other organ systems. The liver is uniquely easy to target with our current vectors.
Right off the bat, the liver receives roughly a quarter of all cardiac output, either directly or second hand from the digestive organs. Additionally, the liver has a fenestrated endothelium which, while not completely unique in the body, uniquely allows molecules like lipid nanoparticles (LNPs) to access liver cells. Finally, the liver is the site of most lipoprotein processing, and LNPs can be designed to take advantage of the existing pathways to get the gene editing mRNA into the hepatocytes. All this is to say that if you have a genetic condition that primarily effects the liver, there's a lot more hope for treatment in the near term than for others.
Good lecture on the difficulties of finding appropriate platforms for delivering gene therapies to cells for anyone interested [1]
[1] https://youtu.be/6URTjoK58Yc
No they were not. A vaccine triggers an immune response, not a functional change.
mRNA vaccines are highly localized: you get a sore arm because most of it only gets taken up by muscle cells around the injection site, which spend some time producing the antigen and triggering a primary immune response (the inflammation aka the sore arm).
Still it needs to enter the cells all the same.
As for being localized it's true however after vaccine dose S proteins have been detected also in remote locations in the body because you can't make something 100% localized.
If you had an infusion that doesn't trigger immune system you could just increase the dose significantly, put it in the blood and most likely it would have reached all cells that blood reaches.
Last I heard those gene editing things lead to so called of-target edits, so they were basically corrupting random dna. Now in this case the baby would have died without this treatment so clearly benefits outweight the risks. But even then they probably want to have the dose be as low as possible.
But I'm speculating a bit here.
This is incredible. Probably the most exciting piece of news I’ve read in years.
Damn what a strange time to be alive. Juxtaposing this against the constant nonsense coming from RFK is as jarring as it gets.
Countless preventable dead children up ahead because that demented lunatic is dismantling basic vaccination in the US. Easily preventable deaths. And never mind the kneecapping of NIH grants (which are largely responsible for this story), or the federal blacklisting of (among others) Univ. of Pennsylvania (where the physician in the OP is based at), over nonsense culture war posturing.
Such endless stupidity. Such a senseless, senseless waste of lives.
Let's be specific, they don't know if he is fully cured. They need more time to conclude efficacy.
I know nothing of this area, but it seems to me this could make cloning easier, right?
Hmm, I thought clinical gene editing (gene therapy) was frowned upon because it's inherently risky and fraught with ethical hazards. What technically and ethically has changed since 2005 beyond CRISPR?
Germline gene editing is still considered risky and unethical. That is, editing cells that form eggs and sperm, thus changing the genome of some of the descendants of the edited person. This is somatic editing. These edits will not be inherited.
Somatic editing is becoming more common (see Casgevy) but there are technical hurdles that prevent its application to many cases.
Can you imagine the emotional rollercoaster of this for the parents
I thought the first gene edited babies were from He Jiankui
Incredible to see science and love come together to rewrite a baby’s future.
What does this mean for longevity research? Could the same treatment potentially be adapted to make edits that could lengthen lifespan of healthy people?
Is this the situation where mRNA vaccinations damaged the baby first and then they had to fix it or is this another story?
No, it’s not what you describe.
Also it seems like you think the mRNA vaccines were harmful. Can you briefly describe what mRNA is and how the mRNA vaccines would have harmed this child?
the road to hell is paved with good intentions. In our lifetimes we will see a brave new world controlled through eugenics.
Gene editing is not eugenics. Eugenics are managed human breeding programs. Gene editing is gene editing.
In fact, gene editing completely removes the need for eugenics programs.
You call it eugenics, I call it biohacking ;)
The wealthy are already engaged in eugenics via IVF embryo selection. There are several American startups whose clientele are mainly rich SV types that want to optimize the genetics of their children.
Gattaca here we come!
There is a strong hunger for Gattaca.
Heck, if parents could provide a trust fund for their kids in a way that their kids couldn't piss it away, they'd be all over it. (I'm sure this exists to varying degrees.)
Look at what wealthy parents already do to get their kids into colleges or out of jail. I think it's ridiculously naive to think that we parents wouldn't jump at the chance to write generational wealth into our kids' genes.
(This is not an argument that developing this capability is a bad thing and should be stopped.)
Fertility care often already included testing for common genetic disorders, and parents with a history of severe disease would often make the hard choice to try again. Due to recent Theocratic political shifts, it means more families will face the worst possible life for their children.
Gattaca was a film years ahead of its time, and raises the question of what happens when people try to "fix" human beings beyond disease prevention. A subtle, but important ethical difference. =3
Disease is fuzzy word, it basically means below some made up bar for healthiness. Take dyslexia as a simple example. That disease can by definition not exist in an illiterate population. We have raised the bar and now they are diseased in need for a cure.
The more we things we cure the higher we will reach and the higher we reach the higher we will raise the bar. I don't think that's a bad thing, but its worth bearing in mind.
One can not simply raise valid concerns about gene editing technologies in the hands of the entities that don't hesitate sending people en masse to kill and die and otherwise manifest their fascist cravings in the open, here on HN and walk away undownvoted
I think it was here a few years ago that I read a comment saying that sick children will be the Trojan horse for normalizing gene editing of humans, because who could say no to sick children, right? Well, guess it's here now, so how long utill the eugenics wars start?
It's not a slippery slope. Fixing defects is rather straightforward, since it's usually a single gene that needs to be edited.
If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes.
For this reason I do not think that curying diseases will lead to designer babies.
If you can affect germline cells, then I don't see how it's not a slippery slope. (I'm not arguing against doing it, just that it is a slope and the slope is slippery.) No designer babies necessary.
I'll steelman "fixing defects" by sticking to serious hereditary diseases (and yes, only those that correspond to one or a few known genes). As more and more conditions become treatable, the population with access to resources will have lower healthcare costs by being less susceptible to problems. (Which is a good thing, note!) Insurance companies will have more and more proxies for differentiating that don't involve direct genetic information. Societally, "those people" [the poor and therefore untreated] cost more to support medically and are an increasing burden on the system. Eugenics gains a scientific basis. Do you want your daughter marrying someone genetically substandard, if you don't have the resources to correct any issues that might show up? Probably not, you're more likely to want to build a wall between you and them. Then throw over anyone who falls behind the bleeding edge of corrections.
It'll be the latest form of redlining, but this time "red" refers literally to blood.
I'm a fan of saying there's always a slippery slope, it's just a matter of the parameters.
But, I think that it's misguided to apply the human problem of othering to a given technology. Regardless of technology X, humans are gonna human. So, if X helps some people, we should consider it on that basis. Because without X, we will still have an endless stream of other reasons to draw red lines, as you allude to. Except in addition we'll also still have the problem that X could've helped solve.
If gene editing to cure diseases leads to a future where people want to shunt off the poor that are now the outsized burden of the healthcare system, the answer from where I sit is to find ways to make the gene therapies available to them, not to cart them off to concentration camps while they await extermination. This will require all the trappings of human coordination we've always had.
Preventing X from ever coming to fruition doesn't at all prevent all possible futures where concentration death camps are a possibility. To me they are orthogonal concerns.
Even if you can convince one culture/society not to do it, how do you stop others? Force? Now you have a different manifestation of the same problem to solve. Society needs to learn how to "yes, and..." more when it comes to this stuff. Otherwise, it's just war all the way down.
>For this reason I do not think that curying diseases will lead to designer babies.
Well, you're wrong. Where is the line drawn for what constitutes a disease? Retardation? Autism? Eventually every child below, say, 130 IQ will be considered disabled and unable to find work.
Apply this to every other trait: cardiovascular health, strength, height, vision, etc. All forms of weakness can be considered a disease. The end product of eugenics is that mankind will be made into a docile and fragile monoculture.
>If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes.
And? it's obvious that the technology will eventually be capable of this, just not all at once. It starts with single-gene mutations, then it will be 10's of genes, and then hundreds and thousands.
That is the slippery slope: there is absolutely nothing about your reasoning that prevents one step from leading to another.
He wasn't saying that curing diseases wouldn't lead to designer babies because he objects to the idea (though he might). He's saying that the factors that lead to a "130 IQ" score are, to the extent that they're causatively genetic at all, highly polygenic. Molecular genetics results aren't putting us on a track to predict polygenic behavioral traits (I guess except smoking?), let alone control them.
It's helpful to evaluate claims on this thread in the context of the story. It's possible (though still a very open question) that complex behavioral traits will generally become predictable or maybe even controllable in the future. But those would require breakthroughs (including basic science discoveries breaking in the direction baby-designers want them to) more significant than the announcement on this story.
You're certaily unfamiliar with the term "incrementalism" and its workings
No, you're assuming that polygenic trait control "scales" like a sort or even a search algorithm, when there's some molecular genetic evidence that it may instead scale like a cipher key size.
For a nice thoughtful imagination of said future, Nancy Kress's Beggars in Spain https://en.wikipedia.org/wiki/Beggars_in_Spain suggests one possible outcome. It has both gene editing to make better humans and unproductive masses. A short yet powerful read.
Well a sick child has been healed so that necessarily means we will have a war about it?
it's unclear the outcome of this will be eugenics wars.
Answering the real question- it's unlikely these techniques will see widespread "recreational" usage any time soon, as they come with a wide range of risks. Further, the scientific community has learned a lot from previous eugenics programs; anything that happens in the future will happen with both social and political regulation.
It's ultimately hard to predict- many science fiction writers have speculated about this for some time, and social opinion can change quickly when people see new developments.
That's part of why the trojan horse works so well, what is an unacceptable risk for someone healthy can easily be acceptable for someone with an otherwise untreatable condition. Then by the experience and knowledge gained, it becomes less risky for everyone.
The problem won't be that there will be those who want to have babies with edited genomes, and those who oppose that.
It will be that people just don't have children at all.
I think one reason why people won't have children is the gene-editing and the IVF that is coming. Nothing is left to chance, or to god any more. Having children is now a clinical affair. It's spiritually void.
I think i'm fighting on those wars right now, you can also call them 'darwin wars' i suppose... but bear in mind i'm crazy and online
[flagged]
I think part of the problem is that “really good” and “really bad” are not universally accepted norms for any given ethical question. What you’re seeing is your own value system assumptions being checked.
It’s perfectly reasonable to say that while a technology has the propensity to be used for evil, it also has positive applications and that the real benefit now outweighs the potential downside in a hypothetical future.
Otherwise you will go down a rabbit hole at the bottom of which lies a future where we all just kinda dig in the dirt with our hands until we die because every technological innovation can be used in a variety of ways.
Like, it’s silly to me that I can’t bring a 1.5” blade keychain utility knife on a flight, and then they hand me a metal butter knife in first class. I could do way more damage with that. But they allow the butter knife because the utility has shown to far outweigh the potential downside that hasn’t manifested.
> I will slaughter a baby if I know for a fact that baby will grow up to be the next Hitler
This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
>This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
It's true. But things like this should be easy to say right? Like we may not be able to act logically. But we should be able to think logically, communicate logically and show that we are aware of what is logical.
My post got flagged meaning a lot of people can't separate the two things. So for example I may not be able to kill the baby in reality, but I can at least see how irrational I am.
The person who flagged me likely not only can't kill the baby. He has to construct an artificial reality to justify why he can't kill the baby and why his decision must be rational.
I think things like that should be easy to say, if by that you mean censorship. Sure. But talk is cheap. And there are gradations of reality.
It would maybe be easier for a 15-25 y.o. to kill a baby they don't know and whose parents/family they don't know, and maybe even easier if they don't speak their language or look like them. Of course, the baby wouldn't be the only one you'd have to kill, most likely.
I submit that it would be very very different if you found out that your 4 year old child was going to go on to be the next Hitler. For a "normal" person, I think they would go to the ends of the earth to try to shape them into the kind of person that wouldn't do it. I think very few people would coldly calculate "welp, guess I gotta execute this adorable little child I've grown so attached to" as it looks up at them saying "I love you so much forever, mommy/daddy" with their little doe eyes.
(ETA: it also brings up side questions about nature vs nurture and free will)
And then consider the lifelong repercussions of the emotional fallout. You can use all the logic in the world to justify the action, but your human brain will still torment you over it. And likely, most of the other human brains that learn about it would torment you as well.
---
So, while I think you can say things like that, ie the ability and allowance, I think you should question whether you should. I think saying those kinds of things really doesn't add much to the discussion because I believe it's really just an uninformed platitude that only someone with a lack of life experience would believe.
For me this all highlights the fact that meaty ethical questions don't have a simple reductive answer. Which ties back in to the original problem that OP outright states that this is simply and clearly the wrong path to go down.
(PS the downvoting/flagging could be due to breaking the guidelines around discussing downvotes and flags, and not actually due to the topical content of the posts, and/or assuming bad faith on the part of other users as such: https://news.ycombinator.com/newsguidelines.html)
The anti-eugenics guy just said he would "absolutely" murder a baby...?
I would if I can foresee the future. But with eugenics you can't foresee the future. Self artificially selecting for genetic traits doesn't guarantee a good future. There's no gene for recreating Hitler either.
[flagged]
A baby Hitler gaurantees a future with a grown up Hitler. Killing the baby eliminates that future.
There could be other babies that can also grow up to be future Hitlers. So let's say 4 such babies exist. By killing one I eliminated 1/4 for futures with Grown up Hitlers that exist.
This whole thread is getting flagged. Likely by an irrational parent who can't even compute natural selection, babe, and Hitler all in a single paragraph.
[flagged]
>KJ has made medical history. The baby, now 9 ½ months old, became the first patient of any age to have a custom gene-editing treatment, according to his doctors.
This is _not_ the first human to be treated with a treatment under the wide umbrella of gene therapy based on their own edited genes. There probably is a more narrow first here but the technical details get lost in journalism which is a shame.
"Custom" in that this therapy was designed AFTER a specific patient showed a need, and then given to _that_ patient. In most every other context a particular class of disease is known, a drug designed, and then patients sought that have that disease that matches the purpose of the drug.
What's intriguing is not the 'custom' part, but the speed part (which permits it to be custom). Part of what makes CRISPR so powerful is that it can easily be 'adjusted' to work on different sequences based on a quick (DNA) string change - a day or two. Prior custom protein engineering would take minimum of months at full speed to 'adjust'.
That ease of manipulating DNA strings to enable rapid turnaround is similar to the difference between old-school protein based vaccines and the mRNA based vaccines. When you're manipulating 'source code' nucleic acid sequences you can move very quickly compared to manipulating the 'compiled' protein.
I want to say, maybe it's better to say first human under proper IRB/regulatory compliance. Some rogue academic in China tried it a few years ago, if I recall, but with absolutely no oversight and he was pilloried. Also I don't think there is much details about what he actually did...
https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
What the Chinese guy (He) did was completely different. He permanently altered the germline in embryos, which means that every cell in the resulting baby is transformed permanently with the change he made. The work he did violated a wide range of good practice (specifically, the change he made didn't actually work for the goal he desired, and he also ignored all the ethical advice around this experiment, and avoided getting the necessary approvals).
This research is instead a therapy used to treat an already born baby, and it doesn't modify all the cells in the body. Many cells in the body that are transformed by this technique will eventually die and be replaced by clones of stem cells which weren't transformed. I haven't read in detail about whether this therapy targets stem cells, and how long term effective the treatment will be- hepatocytes (liver cells) turn over constantly, so I would expect if the treatment did not affect the hepatocyte stem cells, it would only last ~months and the treatment would have to be repeated.
The major difference is that was a hereditary change. So those changes could now diffuse throughout the species over time. As I recall it was a change that reduces vulnerability to HIV infection.
Okay, I'll bite: Who then was the first patient of any age to have a custom gene-editing treatment?
I know of at least one YouTuber who took a homemade treatment that alerted his GI system DNA to produce lactase so he could eat pizza again:
https://youtu.be/J3FcbFqSoQY
[flagged]
This is an AI-generated response, and is inaccurate.
That was one of the first cases of _germline_ gene editing using CRISPR - NOT "the first instance of gene editing." There have been quite a few other genetic editing tools that predate CRISPR, and there have been other edits using CRISPR that were not of the entire human's genome.
That is not accurate, attempts at gene therapy in humans go back further than that.
https://www.whatisbiotechnology.org/index.php/science/summar...
Ah yes, the "neutral" tone of AI generated content. "significant controversy and ethical concerns," sure.
There are always those concerns.
I wonder if this also affects germline cells so he won't pass the same disease on to his children. If it does, that would be a complete departure from almost all medical treatments we use because most of them are just compensating for the effects of bad genes and leaving them in the gene pool to degrade the health of future generations.
Are the edited genes inherited, or the original ones? Does the previous question have an answer that depends on the babies sex?
From an evolutionary perspective it‘s interesting how the further medicine gets, the more we inherit genes unfit for life without medical support.
No, it's only in the liver, from what I can tell from the science, not the gametes.
No, it would not depend on the sex of the baby, as the chromosomes that you're editing aren't X or Y.
Evolutionarily, the inheritance of genes is a far slower process than the medical advancements we make, so what I think we're seeing here is a chasing down of the low probability events. In that, most of the evolutionary pressure is coming from things like dirty water and bad food, but as we're solving those low hanging fruit, we have to go to lower probability events to make progress that feels equally important.
Also, if I am wrong here on the answers to the questions, please correct me!
If they could get complete delivery to the liver stem cells, then the change could be permanent, although this is making many simplifications.
Organs in your body usually keep some very old cells (formed in the embryo) around which act as parents for all the new cells in an organ. Any cell can only divide a limited number of times, so they typically maintain a "tree structure" where the old cells create children and grandchildren (etc) that then differentiate into the organ-specific cells that do the actual organ work.
If you modify only the differentiated cells, eventually they die, and are replaced by descendents of stem cells; if those stem cells didn't get modified, their descendents will not have the fix, and the treatment efficacy reduces over time.
That‘s what I was asking: Baby females already have all the eggs they will ever have once they are born, right? Matryoshka doll style. While sperm is always (relatively) fresh.
I'm sure we'll be editing these diseases out of the germ line at the same time in the not too distant future.
Speaking as a person whose friend died at 21 from complications related to cystic fibrosis I would like to see these diseases edited out of the germ line.
Is the global gene pool actually degrading though? I only ever hear that in thinly veiled attempts at advocating for eugenicism. And it never comes substantiated by any research.
Anyway, this baby proves we can fix hereditary diseases now.
> eugenicism
That comes in many forms:
Black/dark one, nazi style, where you outright sterilise or even kill those with unhealthy/bad genes.
And white/peaceful one, where you‘d appeal to those with unhealthy/bad genes not to procreate and encourage those with healthy/good ones to do.
You can‘t seriously tell me it‘s not extremely unethical for people with huntington‘s disease or cystic fibrosis to have children.
couldn't be unless they reached reproductive cells.
Good thing RFK pushed out the official overseeing this financing and the current administration is actively defunding the organizations that produced this.
Better to have more disabled or dead babies instead of science.
/s
The current administration doesn't care about kids. They only want you to not terminate a new kid from being born. That they care lots about. What happens after birth is not their concern. Also, I think when they say they want more babies, they want a specific subset of babies to increase.
Genuine question: is this research not being pursued in China?
A Chinese scientist claimed that he did CRISPR on twins back in 2018. https://www.science.org/content/article/crispr-bombshell-chi...
He was jailed for illegal medical practices but it seemed like he established a proper lab after serving the sentence and hopefully he is focused on less objectionable practices. https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
Yes, other countries are pursuing this.
it is.
[flagged]
RFK runs HHS which oversees multiple grant, research, and review organizations in the federal government. This includes the NIH, which has been gutted of experts that don’t share the political ideology of the political arm of the executive and / or aren’t willing to say untruths in service of their political agenda. The news is replete with stories of experts being purged leaving entire areas of research unstaffed; from various cancers to HIV to genetic engineering. Of course the same is true in other areas, such as NOAA, EPA, FEMA, etc that will cause more acute harm. The research harms will play out over decades.
From a purely utilitarian perspective, funding research like this is not an effective use of dollars at the margin. How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking? How many people could we save if we stopped spending money we don't have to do things that the government isn't competent at allocating anyways?
That's not to say the research itself is not impressive nor important, but think critically about the fact that this money doesn't exist in a vacuum.
I think you may be operating under the assumption that the extremely expensive price tag will need to be repeated for each patient.
In reality, as this process becomes more mature it is going to become inexpensive.
The reduction in cost will almost certainly be similar to reduction in cost needed to sequence an individual's genome, which has fallen from tens of millions to hundreds of dollars.
The only catch is that we have to spend money to get there.
Another catch is that the nations who underwrite this research will turn millions in investments into trillions in dividends and the stingy or poor will be left in the cold.
Seeing that private enterprise is only good at taking publicly-funded work and patenting it, and that in the absence of public funding nothing ever gets invented, we should be all-in on this.
edit: it's apropos that you mentioned obesity because GLP-1 drugs are the direct, irrefutable, product of spending at government labs.
edit2: specifically, a single government scientist playing around with lizard saliva in the 1970s because he thought it was interesting.
> In reality, as this process becomes more mature it is going to become inexpensive.
There's no evidence to support that gene therapy will ever be inexpensive. We can merely say that the process may become less shockingly expensive.
> There's no evidence to support that gene therapy will ever be inexpensive. We can merely say that the process may become less shockingly expensive.
A similar thing has been said about so many cutting edge therapies and technologies in the past that I think you'll end up being quite surprised.
Eventually someone will invent a machine that spits these therapies out like espresso machines.
What should we as humanity, as society, spend most of our wealth and resources doing?
Sending robber barrons and their girlfriends into space?
I'm of accord with the Utopians of Ada Palmer's Too Like the Lightning:
When a Utopian dies, of anything, the cause is marked and not forgotten until solved. A fall? They rebuild the site to make it safe. A criminal? They do not rest until he is rendered harmless. An illness? It is researched until cured, regardless of the time, the cost, over generations if need be. A car crash? They create their separate system, slower, less efficient, costing hours, but which has never cost a single life. Even for suicide they track the cause, and so, patiently, blade by blade, disarm Death. Death, of course, has many weapons, and, if they have deprived him of a hundred million, he still has enough at hand to keep them mortal. For now.
>There's no evidence to support that gene therapy will ever be inexpensive.
My prediction is based on the number of efforts, too numerous to list here, being undertaken to develop lab equipment to automate the extremely labor-intensive workflow and the accumulation of vast libraries of CRISPR-Cas9 screens and dependency maps, the creation of which are also expensive and labor-intensive.
All those wasted dollars and time put into the discovery of the germ theory of disease instead of growing and distributing food to the invalids.
It's super effective funding.
There are known DNA changes that would probably help all people with chronic diseases, but it's ethically more accepted to go for the more fatal diseases and cleaner cases first, like a rare mutation with a high fix rate.
30 million people in the US are affected by "rare" genetic conditions.
Yes, but the cures here aren't general. They're highly specific, and the rare conditions have a long tail- large numbers of different conditions, each with a very small population of affected individuals, and likely, the treatments will be somewhat customized for each type of disease.
See my comment above. Getting approval for rare diseases and expanding the indication to the common form of the disease is a well established strategy in pharma.
yes, but that's totally different from coming up with a generalized treatment for a wide range of "rare" diseases.
Also rare genetic diseases give insight into the underlying mechanisms and pathology of common sporadic diseases, which can be leveraged to develop new and better therapies.
Getting a new drug or therapy approved for a rare form of a disease and then expanding the indication to the common disease patient population is a well established strategy.
Given the admin’s propensity for cutting spending on research like this and other domestic interests while ratcheting up military spending I think that poster’s point stands.
That is not comparable at all. To save people from obesity, smoking and drinking, you don't need more resources on fundamental research. You need different education, and socio-economical programs, possibly even less funds on the overall: if no resources is spent anymore in promoting bad habits, you end up with more financial resources and a healthier population.
Instead if no resources is allocated on developing all the technical requirements to do such a thing, humanity ends up with less tools to heal itself, and that's it.
With that line of thinking you would never do any advanced science.
a) that statement above has nothing to do with RFK
b) the whole point of NIH and other government research funds is to pay for this sort of "not clearly an effective use of dollars" type of research that Pfizer et al won't touch. but you can look at a ton of future applications from this - lipid packaging, CRISPR methods, drug delivery, etc that had to be devised, and could conceivably be commercially viable if the methodology is perfected and the cost comes down.
I admit to having a similar thought to this - especially if it is then going to be commercialised and sold for millions of dollars per treatment.
BUT the long term view of creating a technology that can treat any genetic illness (or maybe even any illness?) must outweigh that _eventually_
A huge amount of money went into researching anti obesity medications
Which it's worth noting, succeeded so wildly that 1/5th of Denmark's jobs growth last year was related to Ozempic production.
I’m glad we don’t only think from a utilitarian perspective then.
It's not even that. Utilitarian premises still let a very broad set of perspective. A long term perspective on large humanity won't lead to same conclusion as what will be the most joy inducing experiences in the next 24h for the 1% wealthiest people in the world right now.
How do you know it's not effective? The cost per life saved is extremely high now, but this stuff gets better over time. How much did penicillin cost to produce originally?
Isn’t penicillin just bread mold? So probably not a great example.
And yet, the first patient treated with mass-produced penicillin used half the total supply, and the stuff was so rare that it was extracted from patients' urine for reuse.
Early penicilin was rare enough that they collected the urine of the first patients and re-extracted penicilin from it for further use.
This argument could be used to stop absolutely any research that isn't dirt cheap.
Maybe even the dirt cheap one, because even 100 dollars could go longer way somewhere in the Sahel.
It is good that the humanity does not have a one-track mind.
I’ve thought about this recently as well and I don’t know if I have a fully developed view. What is the moral responsibility of all people to pay for medical research or operations that would affect a small number of people. Is it ethical to compel others to pay for the research deemed valuable by some, but not by others. Who is the arbiter of that research’s value?
I could say I believe the government should fund research into fixing people who think cilantro tastes like soap because for most of us it is delicious and promotes healthy diets. Should I be able to compel (tax) you to pay for that research?
Where that line is drawn will always be wrong to someone. How research is prioritized will always be wrong to someone. Is there an ethical way to determine the best use of collective resources and what portion of one’s property must be taken from them to fund that research.
> How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking?
How confident are you the answer isn't very close to zero? We've already curtailed smoking quite a bit in the past 30 years. At the level of an individual, it isn't any particular mystery how to stop obesity or to simply not drink, but population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains. Throwing more money at the problem doesn't seem like it would obviously change that.
Also keep in mind that overeating and alcohol addiction have significant genetic components. Research into gene editing has the eventual potential to cure damn near any disease, including whatever pet causes you personally think are worth defeating.
>population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains
Said like that it paints things like there are not far more resources spent on propagating the bad habits (as some ROI is expected from this by some actors), and any attempt to put a social health program in history always ended in major catastrophes.
It is also capable of creating new diseases that will be resistant to anything we currently have to fight with.
You can torture and execute people with electricity, but it does not follow that discovery and use of electricity was, on the net, a wash.
Somewhere between 0 and -100,000,000
Because reducing obesity, smoking and drinking is not a money problem in the slightest.
I completely disagree, the things you mentioned are all things which a person has a level of control over.
This is something beyond that, and is very valuable as this baby has no actual means of fighting this issue at all.
And who's to say this won't lead to fixing the other things anyway.
Great use of dollars